Description :
From Genome Similarity Track
Location :
Scaffold_905:783- 2442
Transcript NameFunction/comments
g2333.t1POM66197.1 Putative retroelement, partial [Phytophthora palmivora var. palmivora

Sequence
1659 bases(100 bases per row)
TCCATGAGCGTACGCAGCTTCGAAGTCTTGACTTTCTTGAGCCGGCAGCCGATCATCTCGTCCAGCGTCTGGTGTGCGACGTCTGCGACGCATACCGCTG
GCACTTGGACCTCCGTGGCTTCCTCCAGCGACTGCGTCCGCGGGTGTCGCTTGTTGCCGGGCCCGAAGTCTTCGTCCCGCGCAGCTTCCTCTTCTTCCTC
TTCTTCGTTGTCGTCTTCACCCGACTGCGACGAATCTTGATCCGTCGCCTCTTCATCTTGAATGACCACCACCTCCATCTGATGGTAGTCGCGTCTCCCA
CTGTCGAAGACGTCTTCCATGAACTGCGCGTCGCGGCTCATCAGCACGCGACTGCTCTCCAGTTCTTCGAATCGATACGCTTTCTCGTGCTCCGAGTACA
CCAGGAACCGACAGCGCACCGACCGAGCGTCGAACTTGGTGCGCTTCGCCTTCGGCACGTGCACATACGCGTGGCAACCGAAAACTTTCAGGTTCGCCAG
CAGCGGCTTCTTGCCCGTCCAGACTTGGTGCGGAGACTTGTCGTGGCTGATGGCGCGTGTCGGACACCGATTACGGAGGAACGTAGCCGTCATCACCGCT
TCACCCCAATACGTCTTGGGCAAGCCGGCATGTTCCAGCATGCAGCGCGCACACTCCACCAACGTCCGGTTCATCCGCTCGGCCACTCCGTTCAGCTGTG
GCGTGTACGGCGGAGTGAACTTCTGCACGATACCGCGGTCCGCACAGAACTTGGCCATCGCGCCGGAAGTGTACTCGCCACCGTTGTCGTTCCGGAGTGT
CTTCACGCGCTTGCCGGTCTGAGTTTCAGCAAACGCCACAAACTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAATACACGACGCAGAAG
TGCGACTTGTCATCGATGAACGTGACGAAGTAGCGCTTGCCCCCAAACGTTGGCGTCTGCATGGGGCCACACACATCGCTGTGAACCACCTCCAGCACGT
GCTTGGCACGGTTCGGGGACGACTTCATGTAGCTCACTCAGCGTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTA
CGATGCCAACACCGTAGCTCTTCTTGACCGATGGCGTCTAGACCGCCTGGCCATGTGACCAAGGTCGGAGTGCCAAGAGGTAGACGTGGTGTCGCGCTTG
GCGATCCTTCACAAACTTGCCGCATTGGCCTACGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCTCCTTTGCCCTTCACGAGCGCCGCAGCTG
CCACTTGAGACCCTTGTTGTCGCGCGAAGGCAGCCCGTCGCTCTCGAAGGTCACTGGCCGCGACGTCCTTGGTGAAGCGGCCGACGAAAACAGTTGCGCG
ACAGCTTCGGGAATATGCCCACACATTCGTGAGCACACCCTTCTTCAATGCGCGCGGCGTCTTCATCACAATGACCAATGTCGGCCGGTCCCACCGCCTG
AAACCACTTCCGTCGTCCGCGAGATGCACGTCACCGGACCATCGTCTTGTAGTATGCCTCATAGTAACGTCCTTGAAGCTCGTCATCTGCGTCGCCACCG
AGCGACCGCCACATGTCCCACTCGGCCTTTGGCGGTACTTGCTCGTACGACCAACCGAG