Description :
From Genome Similarity Track
Location :
contig_16:782772- 784381
Transcript NameFunction/comments
g4544.t1RAW39825.1 hypothetical protein PC110_g3925 [Phytophthora cactorum

Sequence
1609 bases(100 bases per row)
CTCACTTTCGAATTCGCCTTCCAGTGCCGACGCGGTCTTCCAATCCAAGCTCGCCAGTCTCCGTCCGCAAGCAACCAAGATGCCTCGCTCTCCCGACCCC
AACCATGGGCCAGACTACGCCATCGCCATGTCCCCGGCCACGGACAACGCCAACGACGCCGTCTCAACCATCGAAGGACGAGCTATCGGCGCCAAGTGGA
TCGTCTACACGTCGGCCGGCATCGCCATGCTCGAGGCCTTCCACTACGGTTGGTCGAGTCACCAGATCAACCTGCACAAGTTCCACAACGTGGAGGACTG
TGCTGCCCGCCCAATTGAGGAAGACACGTGCATCATGTTCCCGGGCCACACCAAGACGACGTGGACGCTGCTGTCGAACGCATGGCTCGTCGGAGGCATG
ATCGGGAGCTTCTTGTCGGGTATCCCGTCCAACAAGTACGGGCGTCGGATGACCCTGCGCTTCAACACTATCGTCATGGTCCTGGCCTCGGTGATCCAGA
TTCTGGCGCCCACCGCGGCGTGGTTCGGAGTCGGCCGATTCGTCGCCGGCATCGCCAACGGGATCGCTATGGCCGTGGTGAACACGTTCCTGAGCGAGAT
CTCGACGCCGCACAACCGCCACGCCCTCGGCACCAACACGCACTTGGCTGCGACGCTCGGCATCTTAGGCGTGGCCACGACGTTCTGGTACTGGAACACG
ACGTCGGGTTTCCGCTGGATTGCCGGAGTCCCATCGTGCTGGCCGCCGGCTACCTCGTGTGCTCGTACTTCTTCATGGTTGAGAGTCCCGTGTGGCTCGT
TGCCAAGGGCCGGGAGGACGAGGCTGAGAGGGAGCTCGCTCGTCTGTACGGCAAGGAGCACGTCGAAGCCATGATGAGCTGGATCCAGGCGCGTGACCAC
CGCACCAAGCTGCCGTCGACAGTCAGCGGAGAGTCGGTGCAGATGGAGGCCGAGAGCCCATGGACGATCCTGGCCAAACCAAAGTTCCGCAAGCAGCTCG
TAGTGGCGCTCGGTCTCACGTGCATCAACCAGCTCGTGGGCATCAACGCCGTCTTCTGGTACTCGTCGTCGATCCTGACAGAAGCCGGTATCGCGGACGC
TCGCCTGGGCGTGGCCATCATCGACATCCTCAACGTCGTGCCGGTGCCTATCGCAGCCTACGCCACGCAGTTCCTGCCGAAGCGCGCCATGCTGCTCTGG
GGCATTGCGCTCATGTCGGTCTGTTGCATCGGCATGACGCTCTCTATGGTCTACGGAGTCGGTTGGCTCTCCGTTACGATGCTCGGTATTTACGTGGTCG
GCTACGACGTGAGCATCGGTCCGCTGCTCTGGCCGATGATCGCCGAGTTCTTCCCGGACTCGGCGCGGGGTGGCGCAGTGGGCATTTGCGTCTTCTTGAA
GTGGGTGTGCGCACTCATTATCGGCATGCCTTCCCGTACATTCAAGACGCCATCACCGACTACAGCTTCACGCCGTTCCTGGCCACGACCATCCTCTCGA
TCGTCTTCATCTACTTCATGGTGCCGGAGACGTCGGACTTGACGATCGCCGAGATCCAGAGCGGCTTCCGTGGCGACGAGAACCTGCACTCGGTCAAGAG
TCAGCAGTA