Description :
From Genome Similarity Track
Location :
Scaffold_396:7827- 10389
Sequence
2562 bases(100 bases per row)
TCCATGGTATGGAGATCAGCCACGCCATGGCCATGTGCAGTCGTACCAACGACCGAACCACACGCGAAGCCATCGCACTCGCTCGTAGTACACCCACATG
TTAGTGGGCGCTCCATGGACCATAACAAGTGACAGGCATATCGACTGTTCGTCGATGCCAGCTGACTTGTGCCTCGTACCTTCTGAGCCACGGCAGTCCA
AGGATAACATCAAATTTGTCATCCAAGTCTAATATGATGAAGTCATCATTGTATTGGACTCCCTTCAGTGTATAGGTAATACCCACTACACGTTTCACCA
CTGTTACGGATGCGCCTGTCTCGAGGCGCACCGTCATCCTCGTTGGAGGGATCTCTCGCTCAACATATTCGAGCTCTCTTTTGTCTAGCGATTGGCATCG
TACAAAGTTTTTCGACGCCCACAATCGACTAGAGCTCGAAGCGACATGCTTTGTGTCACTCCGAGTTTCAAGGTAATGAGGGAAACCTCATTACCAGAAG
CAGCAACACACAATGACTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAACTCACTTGACGCTGACCATTTTTTGGCTGTCCGTTACGTTGTTGC
GTTCGCAACAACGTCGGACCCACGCCTTGGACCTCGCTCGGCCGCTTGGCGGTTACTGTTTCCTGCGTACGTGGTACCGCGATCGGGGCACTGCATTCGT
ATGCATAGTGCCCTGTCTTCCGACATCTATTGCATTTTTGCAATTTCCTATAGTTGTTAACACGAGAGCTCTCGTTCCCCGTGGTACAGAGGTCCATTGG
TTCTGGGCCTCCATTTTCCTGTCGTCTCGACGGAAGATAGGAATTCGAATTCGCGTGAGCCTGTTTCACGCTTAAGTCCTCCTGTTCCGTAACCTTTATT
GCCTCTTCTAGGGTGTTGAACTCCAATCGGAACAGGTAGGTTTTAACAGGAACATCAGTCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCA
GTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTACGTCACGTTTACCTTGCTTGATTCTCAGGAGTTCAGAGCGAGC
CCTGAACTCCGCTCGCAGCGGCTCAAAAGTTTGCCTTAGCAGGGACTTGAAGACTTCCAACGACCCAAAGACATATGAGTCGTGTAACTTAAGGCCCAGG
GCCCACGTCTTTGCACGCCCTGCCAAGTTCGATTGAGCAAATGAGATCTGCATTTCCTCATCGACGATATGGCGAGCCTTTATGGCATCGTCTAGTTCCA
CGAACCATCTCAACAGAGAGTCTTCATCGGCTTCCTTGTACTTTGAGATGTCAATCTTTAGAGTCTCGGGTCGACGTATACACGTCGACCCGGTAGCAGT
GGCCTGCTGCTGTCTCAACAGTTCAAACTGTTGAGCACTATGTTCTCTCAACAGCTCTGTCTTTTGAGAACCTTGTTGGTGAAGCAAGTTTACTTTTTCC
CGCTCGACGTCAAGTTCATTCTGAATGAACTTGGCGATGGTGGCATGCTGTCCGTCTGGCCCCAGGGCGAACAACAGTGCGCCAACGGCTTCTTGCCCTA
TCGTTGAACTCAAGCGTTCGACAGCGTCCCTTTCGATTTGACTCAAATGGGAGTAGCTTTCATGCGTGGGATGAAAATCATCCCCCTCATCGTCCAACAT
GTTCATGGTCGTTGAACGGACTACGAAGTGCTACCAGGTGTAACAGGGCACACCTTATTCAACTAACTGAATAAACCTTGCACTGCTGACAGTGCAAGGG
TGTGTGCGTCCGACTACCTCACGTACACGTACGTGCAAAGGAAGATTGTTGTACGGAGTAAGAGTATCGGTAAAGGTAAAAAGTAGAACTGTATTTAGTA
TAGTTAATCCTTTTAATAAATCCCTATTTGACTTCATTTAACTATGTCTAAATTCAAACATGTATTGTAACTATCTGCGCGCCACTCATTGCGTGCTTCT
GTCGTGGCTAGACTTTATTGGTTGATATCGATCCTATATCAACCAATGAGCAGTGTGTTACATCTGCGAAGCATTATCTATTAGGATAATATTGTGTTTG
TCCTAACATAATTTCATACTTGATAATTACCTTATGTAAATTATCATGTAACGGAGGCACCCCGTTACATTTGCTGTATCACGTAATGCTCAATTGTATA
CATGACTAGTCACGAACCATTCCGATGGTCGTCTTTATTTCGACGAGGTTCAGAATCGAGTGCAAAGCGTGCCCGACTTTATATGGCGAGGCAGTAGTTC
TCATCCTTGAAGATGACTGTCTGCTGGAATGGCGCCGGGGTGTTCAACAAATTCGGGCCGAATGACAGGCGCATACAAGATGTTGTCGCTATTTGCCGAA
AACACGATATCATTGTCGCTGAGGGACTACCGGTAGCGCATCACGAGCTTTACCTCGACAAGGTGATCTATCTCCGCAGGTAAAAAGTAGACTGTAGCGA
CTATCGGGCAGATGCCTTCCATTCCATTTGATCTTTGGCAAGGGTCTGTCCTAACGTAGCAA