Description :
From Genome Similarity Track
Location :
contig_16:782656- 784265
Transcript NameFunction/comments
g4342.t1XP_008900153.1 hypothetical protein PPTG_07625 [Phytophthora parasitica INRA-310

Sequence
1609 bases(100 bases per row)
CTCACTTTCGAATTCGCCTTCCAGTGCCGACGCGGTCTTCCAATCCAAGCTCGCCAGTCTCCGTCCGCAAGCAACCAAGATGCCTCGCTCTCCCGACCCC
AACCATGGGCCAGACTACGCCATCGCCATGTCCCCGGCCACGGACAACGCCAACGACGCCGTCTCAACCATCGAAGGACGAGCTATCGGCGCCAAGTGGA
TCGTCTACACGTCGGCCGGCATCGCCATGCTCGAGGCCTTCCACTACGGTTGGTCGAGTCACCAGATCAACCTGCACAAGTTCCACAACGTGGAGGACTG
TGCTGCCCGCCCAATTGAGGAAGACACGTGCATCATGTTCCCGGGCCATACCAAGACGACGTGGACGCTGCTGTCGAACGCATGGCTCGTCGGAGGCATG
ATCGGGAGCTTCTTGTCGGGTATCCCGTCCAACAAGTACGGACGTCGGATGACCCTGCGCTTCAACACTATCGTCATGGTCCTGGCCTCGGTGATCCAGA
TTCTGGCGCCCACCGCGGCGTGGTTCGGAGTCGGCCGATTCGTCGCCGGCATCGCCAACGGGATCGCTATGGCCGTGGTGAACACGTTCCTGAGCGAGAT
CTCGACGCCGCACAACCGCCACGCCCTCGGCACCAACACGCACTTGGCTGCGACGCTCGGCATCTTAGGCGTGGCCACGACGTTCTGGTACTGGAACACG
ACGTCGGGTTTCCGCTGGATTGCCGGAGTCCCATCGTGCTGGCCGCCGGCTACCTCGTGTGCTCGTACTTCTTCATGGTTGAGAGTCCCGTGTGGCTCGT
TGCCAAGGGCCGGGAGGACGAGGCTGAGAGGGAGCTCGCTCGTCTGTACGGCAAGGAGCACGTCGAAGCCATGATGAGCTGGATCCAGGCGCGTGACCAC
CGCACCAAGCTGCCGTCGACAGTCAGCGGAGAGTCGGTGCAGATGGAGGCCGAGAGCCCATGGACGATCCTGGCCAAACCAAAGTTCCGCAAGCAGCTCG
TAGTGGCGCTCGGTCTCACGTGCATCAACCAGCTCGTGGGCATCAACGCCGTCTTCTGGTACTCGTCGTCGATCCTGACAGAAGCCGGTATCGCGGACGC
TCGCCTGGGCGTGGCCATCATCGACATCCTCAACGTCGTGCCGGTGCCTATCGCAGCCTACGCCACGCAGTTCCTGCCAAAGCGCGCCATGCTGCTCTGG
GGCATTGCGCTCATGTCGGTCTGTTGCATCGGCATGACGCTCTCTATGGTCTACGGAGTCGGTTGGCTCTCCGTTACGATGCTCGGTATTTACGTGGTCG
GCTACGACGTGAGCATCGGTCCGCTGCTCTGGCCGATGATCGCCGAGTTCTTCCCGGACTCGGCGCGGGGTGGCGCAGTGGGCATTTGCGTCTTCTTGAA
GTGGGTGTGCGCACTCATTATCGGCATGCCTTCCCGTACATTCAAGACGCCATCACCGACTACAGCTTCACGCCGTTCCTGGCCACGACCATCCTCTCGA
TCGTCTTCATCTACTTCATGGTGCCGGAGACGTCGGACTTGACGATCGCCGAGATCCAGAGCGGCTTCCGTGGCGACGAGAACCTGCACTCGGTCAAGAG
TCAGCAGTA