Description :
From Genome Similarity Track
Location :
contig_4:782403- 783552
Transcript NameFunction/comments
g1390.t1hypothetical protein

Sequence
1149 bases(100 bases per row)
CCAGTAGGTCGCCCCGCACCGACTGGCCCCGTCCGTTTTTTGGCTGTGCGGCCGGAATCCTTTCGTCGGGCGTGACGTGCTTCATGTGGGCGAGGATCGG
AGCTGGCGCGCGGCACACCGCCGCGCGATGACCAGGCTTTCCGCAGCGGAAACAATTCAGCGAGAGGTCATTCTGACCACCGCGGCCTCTCCCAGAAGAC
GACCACCGTCGGTTCTGCGAAGCCTCGATCGCATCGATCTCCATTGGCTCGGGTACCGACACCCGAGTGCGCAGGCATCGTCTTGGCGTATGACGACGTC
ACCAGGTAGTCCTCGCGTAGCGCGAGAGCGAAGGCTTCTTCCAACGTGGCAGGCTCGGCGCGCGTGAGACAGTACCGCGTCATACCTTCACACATACCAA
ACACAAAGACATGGACTTGGGAAGCCATGTCGATCGGCTTCGTGACGATACACGATGCAAGGTGTCGCGTTCTCTGGACGTAGTCGCGCATGGCCATCTT
GCCTTGCTTTAGGGCGAAGAATGTAGCTCGAACGCGCGACTCATCTTGCGGTGGTTCGAAGGCGAGACGCAGGTCGCTCTGGAGTGCCTCCAGAGTCGGG
AACGCGTACTGGTCGACGACAAGTTTGCCGAGAGCCCATTCTTTGGCCTTTCCGGATAAACGGGATAGCAGGAAGTTCACCTTGGCTGATGGCGCCTCGA
TTAGCCTCGAGGCGATCGCGATGTCGATCTCTCTGAACCAGCGATTCAGAGGTAGGCGATCAGGACCCTCGCCAGAATAGGAGGATGTCTCCATCTTGAC
GGCATTGTTCCTGGACGCATGCGAGGGAGTTGATACTCGCCGTTTTGCTTCGGCGAGCTCGCGGTCCATGAACTCTTGGATGGCTTGGCGCTGTTGGTCG
GGGGTCGCTGAGCTCAGCAGCGACGTGACGACGGTTTCTCCGGACACCGCCGCGAGGCGGTGCAACGCTTGCCACTCGATAGACGTGAGATGGGGGAAGG
CCGCGTGTTCCAGGGTCATCACTGGAGGTCCGGCGGGCTGGTCTTCACTCATCTCGAACTTAGTCATGGGAAGGACTACGAAGTGCTACCAGGTGCAACG
GGCCAGGTGAGTGCCCGTCACTAGCTTACACTTAGCGGTGAGGAAGCGT