Description :
From Genome Similarity Track
Location :
Scaffold_12:782334- 784031
Transcript NameFunction/comments
Physo_529610DEAD/DEAH box RNA helicase, putative

Sequence
1697 bases(100 bases per row)
GACTCGGAGGACGAGCAGGAGGCGGCGGAGCTCAAGAGCGCCGTGCTGAGCCGCCAGCAGCAGCGCAAGGAGGCGCAGCAGCAGCAGAAGGAGAGCGAGA
TCGCCGAGGACTTTGAGTTCGACGACGGCGGCGCCTTCCACACGTCGGGCGGCAGCTCGTGGGACTTCACGGCCGCCATCTCGCGCATTGACAAGATGGA
GAGCGGCATCCCCACGGCCACCAAGCGCACGTCCATCCAGGCCAAGATCGAGAAGCGCCGCAAGGAGAAGGAGGCCGAGAAGCAGGCCAAGAAGGAGAAG
AAGGCGGCCAAGAAGGCCAAGAAGGCCAAGAAGGAGGAGAAGGAGCAGGAGAAGGAGGAGAACAGTGGCAGTGAAGAGGAGGAGGAGGAGGATGGAGACG
ATGAGAACAGTGACTCTGAAGAAGAGAAGGAGGAGGAAGAGGAATCGGAGTCTTCTGACGACGAGAAGGAGGAGCAGGACGTGGAGGAGGACGACGTTGT
CGTGGAGGAGGAGCGTCTCCAGTCGGCGCTCAATGACAGCAAGAAGGACCAGCAATCGCGCGAGGAGCTGGTGGACGCGCTGGAGAAGAAGAAGGCTGCC
GAGTTTTTCGAGTCGGACCCTTTCGCCGCCGAGGAGTTCGCCAAGACCAGGTTTGAGACGTTCGCCGACTTGAAGCTGTCGCGCCCGATCATGCGCGCCA
TCTCGCACATTGGCTTCGAGAAGCCGACGCCGATTCAGCAGCGTGCCATCCCCATCGCGCTCACGGGCAAGGATATCTGTGCCAGTGCCCAGACGGGTAG
TGGTAAGACCGCCGCCTTCTTGCTGCCCATTCTGGAGCGTCTGCAGTTCCGTTCGCGTCGTGTGCAGTCCACGCGCACGATGATTATCTGTCCCGTGCGT
GAGCTGGCGACGCAGTGTCAGTCGATGTTCGAGCAGCTGGCGCGCTTCACGGACATTACGTGCTCGCTGGCTGTCGGTGGTTTGCCTCTGAAGGCGCAGG
AAGCGGAGCTGCGCAACCGCCCGGACGTCGTGGTGTGTACCCCTGGTCGTATGATTGACCACCTGCGTAACTCCAAGAGTGTGCACATGGATGACCTGGA
GATTCTCGTGCTGGATGAGGCCGATCGTCTGCTGGAGCTTGGTTTCACGGAAGAAGTGCTCGAGCTGGTGCGCATGTGTCCTGTCCAGCGCCAAACGATG
CTTTTCTCGGCTACGATGACGTCGAAGGTGGACCAGCTGATTGACCTGTCGATGAAGCGCCCCGTTCGTATCAGCACGGACCCGTTGTTCGACATGGCCA
AGCACCTGGTGCAGGAGTTCGTGCGTATTCGTCCGAACCGTGAGGACGACCGTGAAGCTATTCTGCTAGCGCTGTGTACGCGTACGTTCCGCACGAACAC
TATCGTGTTCATGGAGACCAAGTCGCACGCGCACCGTATGATGATCATTTTCGGTCTCGCAGGCATCAAGGCTGCCGAGCTTCACGGTAACCTGATGCAG
AGGGAGCGTCTGGAGGCGCTTCAGAAGTTCCGCGACGGCACGGTGGACATTCTGCTGTGTACGGATATCGCTGCTCGTGGTATCGATGTTCGTGGAGTGC
ATGCCGTCATCAACTACGAGATGCCCAAGGACATCACGACTTACGTTCACCGTGTCGGTCGTACGGCTCGTGCTGGCCGCAACGGTCGCGCTGTCAC