Description :
From Genome Similarity Track
Location :
Scaffold_97:78205- 92192
Transcript NameFunction/comments
Phyca_LT1534556876putative B-box zinc finger protein
Phyca_LT1534511761CTP synthase, putative
Phyca_LT1534511763putative dGTPase
Phyca_LT1534130716predicted protein
Phyca_LT153451185Hypothetical protein
Phyca_LT1534130774caltractin
Phyca_LT1534130737predicted protein
Phyca_LT1534130731Hypothetical protein
Phyca_LT153450868Temptin

Sequence
13987 bases(100 bases per row)
tctgagctcattttgcgccgtagcagcgttgaccacgcgctacttccgcgacgtcgtcgaggggataataactcgtcgtctgggcggttcttggcatttg
gttgcactgaaaactctctcaaaatggaggtggagtcatttgacagtccaaccagtggaagctcaaagcgagaacggggtgatacatcagcttccccact
ctttctgacgctgttctggacgaagacatcgcggcggatttcgtccaatagctgctggcattgtggagatatcacgtttcttgatgccatgaaggtacca
tgggaatccgcgggaagagctcctttcaagttgagtagccgcttgcggacgtcgttgtctccaccacggtgatgttgcgctagaagggcggcagtcttta
gttctacttgtgagccatcgatgagggttccctggttaccattgtcaccttcattgattgctggatcaacatcacctgacggtactgaaatccgctggtg
tgaagttgctaattgatctgccgacaggacgagaagctcacctgtgagctgtaaatcggctttcacctggtccgctctgttgttggagccatgcgcaaag
ggagggaagtcgcgctgttcagctcgaagaagcttgtgttgactccaagcagccagaaactccactgctggcagcagagtccggtgatcttcgagacttt
catccacccaatcgatctgctgcaattgtcgctcaaattcaagcgtttcaccggtaagcactcgcattttcaccgctacggcatcatccaaactttgcag
ggcttgcgcacactgctctttgatggcagctgcaacttgtgccttgttttcctggacgctacattgaatccgagtcaaaatttggagcttattttcgatc
accgtcttgcgtgaggtgatcagtggatcggggcgcaatgactcacgtatagaactctcataggcatccgcaacggtcagtagtcgatgagagcctttct
ctccgattgagtgatctccaaccattttacaggttacgcacacaggaacctggcacactgggcagtagaactccaccttcttgccatggtgagtgcggca
tgttggcgcctgtgtatcatcggtggctagattatcttctagctgttttacaacaatctcgctgacctgtgcttccgttagttccacgttgttttgaggt
tgggctgggttcaagagggtttccggaccaatttccgcgattgcagcagctaatgatggtgccgagctacgacgtctgccgcgcccaccagctccagttg
ctactgtcttggacttgctgcgtaatggcgtccgcttgtgacgacgcaccaacttattggccgagtgaacttcttgatcgcattgagcacagatctgagc
ttcacagttgcggcactggacagccgcaggatgctgctcacaaagggcgcaagtaccaacaggaccatgcgcgtcagcagctgagaaggtgaaccgaacg
aggtactgaggtaagatttggagcgtgttgtttaggatgtactcgtgataataacctcgatccagatgagcgtcttgcaggttgttaggaccctggtctt
tgtcggagtcagcttctacttcccgatgaatgtagtaactgtgatacccaggtgggagtcgtcctgtagcctcgtcctcccctcgaatgacaagcgatcg
ccccactgcaatcttacagaggacaaattgccgcgtactggacggcttcttcgagtcagaactctggtttaaaggtgcactgagttgaagatttccagtt
gtgaatttcattcctgtttggttcgcgtcgagagaggtaaatccgtagctatggacgtcgcccatgtcagcaccaatatcgttcattgcaacccaggact
ccagctccagcatcccggttgtatgctgttcatattgggctaccagcgacgggttccgcatgtcccaaatcacaacaccttcatgcagacgatatccggg
caatgagcactgcaacagatactttactcgtgcaaactccttcgtcgattgactcatgggcgtcacactcgccaccgcccctgtagctgggatggtagcc
tggatagcgtcgtcttcttccatatccacgagtatttcaggacaagacgcgacttcagcccccccttcagaggcgggaagtgtcgttgcatcgtccgagt
tgtcatcgccctttgctggacgctctggtgatgtcgcttggacatctcctggtccattgggggcatgagacgataggaacagccgcagccgagctaacga
cgcactcgctttcgcttcttcggcttcgtttactaccatattgggtgagcttattcgtgtcggaaagtgccaacgtgcttaggaactcagtcgtttcaag
tagtgccttttggcttatacaagctaggaatacagttggatctggggtgaacttgcaaaattgcttaaacttttgcttcaacatgcaacttcaacgtcga
tttggcgtgatagctatcaaaacttcatgctgtcacattaaaatgttgtgaagatggccgtgttgcaattggcggaaatagctttcttcctacagcgatt
gcaactggtacagtaacaattgaagtttgctcactccaaatcatttagcgcgccaattgcaagtctgttgtattgttcccgccacctccagacgtccaac
caattttgtctagccctttttctagcacctctacacgggtctctattaaacccatttcctttacaaaagtccgtctttttcttagcgggttcaaacccgt
agctcttcgcgagtcaaagagacaccactgcgcgctagccattcggccatttgttgccagcagtggaagtactttcgtctgacctcttcactctctcacc
atgaagtacctggcagtgaccggaggcactgtaagcggcctgggaaagggcatcaccatcagcagcatcggcgtcgtgctcaagtcgctgggtctgcgcg
tcacgtccatcaagattgacccgtacctcaactgtgacgcaggcacaatgtctccgttcgagcacggtgaagtgttcgtgctcaatgacggcggcgaagg
cgacctggacctgggcaactacgagcgcttcctgggtattacgctcacgcgcgaccacaacatcaccacaggcaaggtgtacacgcacgtgctggagaag
gaacgtcgcggtgattacctgggcaagacggtgcaggttgtgcctcacgttactgacgccatccaggactggatcgagcgcgtcgctcagattggtgtgg
acggcaagcacgctggcgaggctggagctgtggacgatgaggaagctgacgtgtgcctcattgaggttggtggaactgttggtgacattgaaagcatggt
gttcctcgaggctctgcgtcagttccagttccgtgtcggtcccgagaacttttgcctggttcacgtgtcgcttgtgcctgttctcggctctgtgggcgaa
cagaaaaccaagcccacgcaacacgctatcaaggagctgcgtagcgccggcctgtcgcctgatgtgatcatctgccgtagcagcacggagctggagcctg
ccacgaaggctaagattggcatgttctgtcaggttcctgccaatcacgtgctctctgtgcacgatgtgagcaatatctaccacgtgccgctactgctgtc
cagcagggtgctgctagcattctgatgtccaagctgcagctgatggaccgcttcagtgagccggaccttgaagcctggtccgctatggcccatcgtgtgg
actccttcgagcagatctgtaagattgctctggtcggcaagtacacgggtctgcaggactcgtacctgagtgtcatcaaggcgctcaagcacgctactat
gaagtgcaaccgtgatttggagatcgagtggattgaagccagtgatctggaggtggagatgcgcgagagcaaccccaaggcttacgaggaggcctgggcg
aagctgcgcagtgtggacggtatcgttgtgcctggtggttttggtgaccgtggtgtggacggaaaggtactaaccgccaagtacgctcgtgagaaccgtg
ttccgtacctgggcgtttgcctgggcatgcaagttgctgtgatcgagtactgccgcaatgtcatcggctggacggacgctaacagcgaggagtttgacgc
gaacgctggacacaaggcggttgttttcatgcctgagattaacccggaggtcatgggaggcaccatgcgctgcggtgagcgtcgcaccattgtgcacgag
aaggaggacccagcgaagcgctcgctggtgtcttacctgtacggcaaggacaagccgatcctggagcgtcaccgtcaccgttacgaggtgaacccggaac
ttgtgcctgcaatccgcgagggtggcctcaactttgtcggtacggacaccaagggcgaacgtatgcaggtggttgagctcgaccgcgacgtacacccgtt
ctacttcgctacgcagtaccacccggagttcaagtcgcacccgaacgacccgtcgcctccgttccacggcctgatcctggctgctaccggccaactcgag
aagttcatgaaggatgtggaggctaaggagaaggagctgtaagcggctagagacgatggaattactgcgacccaagagctggtggacaacagatgcaacg
atgacgtctttcgaccgatggagctgcaggtttgcgtgtgaataggctaaaatattgatttggacttgtccctccgctgcttttgccttcgtttttcttc
cgtcgaaggaaaacggggcgaagctctcgcggtcgggctccatgtactagacatcaatacaattttactttatttatttcaatccttctccttttctttc
tcctttttaagctgacgtacttaagacatggctacattcttaatgtagccatgtcgttcgaccaatcaaaatgcttatagtggcatacgacgtggcattt
tacaagatgactgaagagctgcaggaggcggtggacggcttcttcttagcggcggaatacggccgttccgacgtcattaaggccctggcagaccatggaa
gtggtcgcctctctctggctgacgtggtggaccctgtgactggccgctcgccgctgcacgtggccgtagcgagtggcaagaaggatgccctgcgagttct
tctggctgctggtttccccccacagcaccaaagcaacagacaggagggcaaagaagatgtcaaccgatctgcctactctctggctcaagatctgaaggcg
caggatctgattctggtgttccaccagttcttaatccaacaagtcgctgccagcaacgttatcagtgtgaatcagttactggaagctggtgtggatgtag
gtgtgactgatgcagctacaggcggatctttgttacattgggcagcgtcttgtcaagcagtggatgtgatgaagaacttgctggagagagaagacgtaca
gaagcagaagctggtaaatgctcgtaatggagaaggagccacgccgttgcacttggcttgccatgctaatcaagtggagtgcacgagaatgctgcttctg
catggagctgatgcaagtttgaaaggggagaaagggatcagtaaggacaaaacggcgctagagctggctaccaaggaggaagtgaaggaattgtttactc
aagagcagcagaagagtgatacggttgctaaaatcgagctacatttggtggagaacgaagatggtgctgaaaacgctacagaagagaatggagatgcgac
ttgtggttcaggaacctgcctgcatgaaatccagaatgggaaattacaattgcagctggaagagaaggaccttcttgtcaaccaattgaaaaagaccatt
gaagttctcgtacaggagtctcaggagatacaaatgcttggagaaaaccgcgtaatgctcgactatgtccggaaactgcgtgatgagaaggcaatcgtcc
agaggcagctcgaggacgcaaatgactacattaaagtccaacagcagcaattggacagtttgaaggagcagatccggcagctagccactggtggaacaca
ggtacgcaatggtagtctacgcgctgacaacatgtgagtgtgtttcttacaaagttaattttttgaagcagcttgagactgaccacgacattctctctca
tactagcgatggcacggttaacagtgtcgcaggcggccctccggacagcactcacagtaacatgagtctattggatttgcatcagaacgagaagcaagta
gatgaagaggacgatgaacctcagaagcctcaagcccagccgttaaaactcgatgcatggacgtccaaggcgcaacgtgagcaagaaactttaatcgata
cgttgaaaagcatggccctgacatctggagtactgtgtggaacggtatctggacaggcaatgaagaaagcgaggcacagaatgaggatggcgaggtcatc
atgacggtgtagaattaaaggccaattgaagaacaaatggattgaatcattcgcagaagaagggcctagcagatcggtgaggcagcgtttggagtgcttt
cttgttgctgctgcttgtacacgctagtgagcagtttttcgcgcttctgaggctgtttgtacagcgcacagttattagcacaagtcgaatttggttcaac
tttaccacaggagcaaagagctggagctccaatttgtgcttgaagagcccgaaggaaacgctcatgctcagtcgtctcagtttgacgaggtggacgcttc
ttagccgattttttcctccatggtgtcgacgatgtggtaacttggcgatggactcgcacgtcacatcctgccgtcatatcgatactattcagaagttgtg
ttagccgtacatgcacaagcggaagtatttcgtacttcactcacattttgactgcagcccagcgttctctcatgtcggtgtgatctgaattaccagcacg
acgagacctactgccacttacagctgctgcaacagagctgcgagacttgactttgttcgttttgggagggtggcgccaaacattgttttgaactttggct
cgattcatctccatgtactgccgcctcactgttgcatacagagcaactcgctgaagaacaaagataataggtaggtcaaagctggcactgacacgaatat
tgccttacctgctctggaagcaaaacgggtgatttagctggttcactttcgttattttccttttcgtaatctggaacgatatacgatcgcgacatttcag
ttgaccgaagtaaatcgtcgcggatctgagcatctgcatgcaagatctagtgcattgcataagacttcatcttggtcagaaaatacaggaacacacacta
ccttttcgatatgtttccctaacgaacaattctaaacaatgtaaagcgagagcattattcacaatttgttctcgctttgaagacgaacctttagtatcgc
cgccttgtcttctttcatttgttgaaagtattcaccggctgatactcgcttatctaaagtgctttcgctttgtcttaccgcctctgtggtataaaaaacc
tttgcacatttttcatcctacacgacgagaatcagcaaactcgagaccattagaattccatacatgtacaactcctaccaagtgattttgtgcacgctga
gccgcaaggcgattttgccgttctcgagctgtcacgcgcatacaaattttgtcgtggaacctcttgagctcgttcgattggatgcgtagtcgaagttcgg
cttcatggcgcaccgactcggtttcagcctgtacatccgattgtgattatctcttcacgttccccaaattgaattcctttgatgagtatacctccacgac
gctgagatcgagccattcggaatcctcttcgtcatctatctcatctctgtagaccccgctacacataacatttagggacgataaaccgagatgaacttgg
aagtagtatacaatacttgttaataaatgcaacggcttcaccaaaactgtaagtacgtcaactatattctttagtaataatgcaaaacgaaccgtgcgga
tctctcctgtctcgttcgtcctcagcaatttgctgagcaaacgcgttcatactttaagagaaaatcgatatgatcctgaaaagacgcactctccaaacat
ggatacatccatgaaaggacgcatgacaagagaatacgagcagaatgccactgacacagtattaccacgtgcgcgatccgatggagaacttgctcgttag
tgtcactctacggaaggcaagacgatagttttgaaagtaaatttgtgtggtgatctaactatttatgttggtagatttcaggatttggaagcgataccag
tgacaactcggtatcggtgggtcgtacatggaagtattgtttccagtggcaagagaaaaagcttagcttgaggtacgcttgaatttttggctttaaagaa
taagtctcatcactttatttcctttccaagcgaaaagaaacgagagcaggagcgtttagaagcaagaggaatccaactatcgaaccgaaaggtgtgtacg
caagttattcagacaccacaagtgttttacgacactaactgggttttaagcatgaagatagaaaatcaacagacggaaccaacgccgatattttgtcttc
gtacgtcgatgttgacgatttcattccgactgaggtatgtgtattggacgaagtttacaaatatcattttgaatttatgaatcgtttaaacgcagcaagt
gaaggaacttccaagtacgtcgaagaatactgagacgcatcttcttccaccggatctcactcgacgaccacgtagcaaacaaaatgaagcttcatggact
tcaaaccagtatcgcgcctggcttcgagctaaccgcgaagataaattccgtgcgatgcacatcgttgcactcgtggaaggtgtggagcgtgtgctttgtt
cgatgcgattttacaaggaaactggactgttctgcgctacacccgggttctcagacccaattgttgaccctgaaacggacccagacgtgttcttaagggg
cccaagcttacaacgtatcatttaactactccttcaggttctttatacgagtacgtactagacaacgaacacgaccttctcccgtttgcttccgctgaag
accaaagactttcaagagagatccgattacaggaggaaaaacgcgatgtagcagaggtgacacgatggcaactgagtaagaatccgaaattgcaaccaac
gatcgctggaaacaacaataggcaacggaaaatgatgatttcgattgaaattgttggagtatataacccagaaacaacggatcctgtgcttgtggaatat
gaactggaactaccgggccgttcagggcattctcagtggaaattacaacctggaaattatatccgtaaacgtggtaaaactgaaatgtcgatacctcaac
gatctgcgtatcctggatatttatctgctgctgcactcggataccatcagcactttaatctaacacttggttcagctgaagcagaagctgacaaagacgg
agatgtcggtagtatggtttcttctccgatcttccatctgagcgtgttttctcgagattcctggcggcggaagagatcactaggccacggagtgataata
ctacgagaaacttccgggttttacgactttgacgtgcctattcgcaaaccgatgctctccatccgcgatcggatggaagaactctttctgggaattgatg
aaagtgatgaagcctttgtgggcgacagagtgcgagagtgtcaagtaaactcggatgatcccctctcaccacaatgatcaccagtcgccttggacagaaa
tcggaatcgacaggcacaaccgtacgaatccgcttcaatatcgtcgatgtacagccaaagagctgtacacgagttgatactacagggttgactcaaagac
ctactgctacacctttcgtcaaaacgcgtgttgtaaaacgaagcgtgcaggaaatactacaatccgttaagctagagaagcgactagctagtataacaga
ccctcgtattcaagcagcactacgctcgctgccttcaactgggacaaaatcaataaagcatgatctagtttagaagtttgtcaaggtgtattgaagtagc
atacgtcttcagtcatcgtcgctgtccagatcgtcaagcgggttaccgctgcgtttcttcatgacacggaagaactcctcttcgttaatgaggccgtctc
catcgcggtcagcttcatcgatcatttcttgcatctcttcgtccgtcaacgtttcgcccagttccgtacagacgcgttttaaatttctaaaggagatttt
ccccgtattgtcgtcatcaaagagctggaagatcttcatgatctcctcgcgcgagtccctggagttcattttgcctgtcatcatctcgatgaactcgtcc
aaattgatcgtcccggactcgtccttgtcgatgtctgcgatcatctggcggatctccgccttcttcacctggaagccaagcgcccgcatcgcggccttca
gctcacgaacgtcaatacttccactgccgtccgtatcgaagaggtggaaagcctccttgatctcctccagatcctcttcatccaacaccttcttcactgg
cttgggtttacgtcgtagagctgcacgagaccgtgcaaaagccgaagcggacattgcactcgactatgaagcacaacacgttactaaacgctgttaaagc
caagatctacacacaagacgtaccatattcagcggttatcgcacaacgaagcagaagccgaagtgtccgttgcagtacatgtacgacctttcatgatact
actttttagaaatgatctaaatcgtaaattccagacttctaaattctgacgatcgtgttctattttaaagattttgtgacgccagcttcatcctgtcact
cttcaattgaccaccaagagctcacttccttctacccctacagtcccgtccatccatgttagctgccgccgcgaagcgcatgcaacggagcacagtacgc
acgctcaaaacctacgacaagagcgagcaccgcgtgctggttattggcggcaatggcttcgtgggcagcaatatcctgcagcgggcagtgcagaaaggca
ttgaagtgcgcagcctcaacccgtcgggcaagccgcagtggcaggacgtaccatggattgaccaagtggattggcacgaaggcgacgtgttcgacgacaa
gcaattggccaaggctgttgagggcgtcacgggcgtcagtgcgttttgaagagctactgaattatgaatatttactgactgaattgtgtaaatgactgca
gtctcaacggtgggagcttttggtagcaatgaattgatggagaaactttgcggggatgccactatcgctgctgctagagctgcgcagaaggcgggtgcag
agcgctttgtgtttgtatccaattcgcgggtcggctcatacttcccgtcgtggttgcctatgcacggttattaccatgggaaggaaagagcagaagctgc
tgtgcaggcgaggtgagacttgttggatattggaggattgttctaaagctgacggatattgtcacaatactacaatactacaatactattgtgcatcagg
ttccctgacactggtgtgtcgttgcgcccgggtttcataaatggctggcgccgcaccaaaaagggtcaaggcatcccgctgcaacttgtcggcgctccaa
tttcgacgttggcacgcgatcttggagcggtttcgactgcgctgagctatttgccctttgctggcgaggaaatgcgagctgcgattcctgtcggtgcagt
cgccaaggctgcggtactcagtgccattggcccggtccacgggcaatccctggacacgaccagtatgctggaacttgctgcttcattccatatccacgag
gactgagcgtggagtgaccacctctttcacgagaaaatttataacaaaagaacgacgaggacagccagtaagtgacgataaaactaaaacataattatga
ttgaagaagtcgctgcaggtgtctatagtctatcgcctcgccattgcttgcgctgtgtacttcatgccaataacaccaatttttttcttgcgttcttcag
cctcgagtcgtcgcttctccagttcctctgttcggtctttccaatattgctgtcaatagagacaagagttcgtcaaggatgcacaattcacttcaaatat
gctcagaactacctccttttgcttctcttgctgtttctccaatttctccttcaaacctttagcatctgcttcactttgctctgcttggtcagtaagacaa
agctcttctaaggtctgtacccagaggtctcggacacttgtgtctcctgctgttagctcaagtagcttttggccgttctgtcccagaagcactaagtcca
aacgacctggacaaacccaacgttgtctggaattaaaatccatagtaaccagctcaatgcaacgttccatacccatcggacaaaccttgccgatccgatg
aatcggaagttcctcagcgctactaggaccgggaatctgtcgccacatcagcctgccacaagaaacaacgactcagtccattataccgcatatcgcctta
caaaaaacacattgttacctcgtagctgcggggttcaactgtaagtaaacattttccgtcctgctgagtacacctaggaacgcgctcttcttcttgaaat
cattgccttctctgagcaactcctgccgggccaacatctccgaattcccaccaccacagcacacattccccatgctttgactgccctttcctttcaaaaa
tacagtcgactgacagaataggatgcgaaactgttttgacaaccatgatcgatcgacgtgtatttctcaagactttgttgggaaaaaatgaaaacaacta
acacagcttcgttcgcagaacttaaggataaaagctggcaacaacaaacgagtggtgacttgtccacttagcggcgcagagttcttttggcagcgcaacc
accacccgaagttggggtcgtgctagagccccaaggagaacccttagtagcgtcaccagatccactagtggatgcaccggtcgttgtgcccttggtagcg
tcaccagctccactagtggatgcaccgatcgtgcccttggtagcgtcgccagctccactgttagagctctcgcttgtgtccgaggtgccgcccttggtgg
catcagctgctccactgttggggccttcagtcgtgcttgaggctcctcctttggtggcatcggcagctccagatgcaccagcagccgaagaagttccgct
cgaacctccctttgaggcgcatgtcgtggctttggtcggcgaagtcgtgaaagccgtcaccgtgaagtcgggcttaccacccttcttccacgtgcaacac
gggtcaccaaaggcggcgccgttggtcatgctcgaaccggggaacttggcctcgcacagacttttcgaccacgtgtgaccagcggcggcgaacgcttgag
caaaatccgacgtctttgaactgtcgtcacctgggtgaccgaggccttgctggaaggagctgccgttcggaagctcgttgagatacttggcgagaccgta
agccgagtccatggtggcgacaaaagccagaatagcggaggcgattgcaatcttcatactagtagtcttgcgttggttgtgggggtttggcaacttggaa
agtgagaaaggtaaccgtgtttggcgtcgaaagacaaacacgtattttacggatagaattgaattgaagatcggccattctggaggtgctgttttccata
tctgccgatgggatatggatccaccagtaatgcaccaacacttattactacagacagcaaaatggttgaggcgggcggatgcacatc