Description :
From Genome Similarity Track
Location :
Scaffold_3014:782- 3929
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3014-fgenesh-gene-0.0Ras-specific guanine nucleotide-releasing factor

Sequence
3147 bases(100 bases per row)
CGATGACAAGCTGAGGGAGTTTATGCTCACAAAGTTCAACCAGAGCGACGCCGAGTCGGACGGAGCGCTGGACATTTTCGGATTCAAGGCTCGTGATTAC
AATCTGGAAAATGGAAGCGACACGGCATCGGCGCACCAGCGGCTGCGCCATCCGCGAGACTTCTTCTCGTGGTCAAGCAAAGATCTTCGTGGCGGATCGG
CTCGTCGGACTTCGTCGCTGTCGCGTGCCAAGTCATTTGACGAGCTGATGCAGACGCTGCTCCACGACGTCTCGGTCGACCTGGCAGACCTCGCGGCGTT
TGTCATGTTTTTGGATTCGTTTGCAAGCGCCGACGCTGTGGTCAAGTATCTGCGCGAGTTCCTCATGGAGGGCTCACAAGGTAAAGCGCTGATAGTGAGG
GTGAGACCAGTTGATTCTGTGCTATACTAATCTGTGTTCCCCTGCCGTTGTAGGCCGCAACTTGCTTCGCTTTGTCGTTGTGTTGCTATTGTTTAAGTTG
CGTCGCTCGAAAGAGAACGAAGGAATCGTCGGGGAGATCCATTTTCTGCTCGAGAGGTGCCGCCGGCACATGCCGGACGACGTCGCCAAAGCGCTGAACG
AGTACAAGGCCATGTTTGCGCAGTATTTCTCGCTGCAAGCGAGTGCCTCGTGCCTCCATCAGTACGCGTCCCTGCCGATTGTGATGCAGCAACGGTACGG
TGGCCAGAACTCACCAAGTTTTTCTTCTCCGTTTCCACGCAACATTTTCATGTAAGTGAGGGTTGAGGCCCGTGAAGAAGCAACCTTATGTGCTAACTAA
CGCTGCGCCATATAAACTGTACGTAGCCAAGTTGAGCCGTCCCAGTGGGCCGAACACTGCACGATTCTCACGCACACGCTGTTCTGCAGCATCCCTGGTG
CGTTTTTGATCTTGGCGTAGTGGTTCGGATTCATCCGCGGCAGTTCTGATGGACTTCGATGGTTTTGTTTGCAGTCGACGATTTCATCTCGACCGGCTCC
ATAGTTCCACATTCCTCGCAGTTTCTTAGTGCCAAGCGTTGGTTCCAGCATGTGAGTGGTGACTGGACTTGTCCGATTCCCTGACAGTGCATTCATTCTG
ATGTGGTAATTATTCTGTATGTGGTTGCAGCTTACTGCGTACGTGGTGAATGCTGTTCTGGTGGAGGACACATGTGAAGGACGCGTCGAAGTGATTAACT
TTTTCCTCGCGGTACACACTGAACTTGGCCTTTTTGTCCTCAGCCGCGATCGAATACTCACCACGCCATATATTTTGTGTAGGCTGCCGAGTACTGTCTC
ACGCTGCGGAATTATGACACGCTTGCCGCCATTCTCTACGCACTGCAATCAACGGCGGTCCAGCGCCTTCGTCGAACACTCGATTGCGTATGTGCAACGC
TTCCTTTGGAGCATGATTTGTTGTTTAGCGTGTGGCTTATTTTTTGTTGCCGATGTTGTATAGCTGACCATGGAGTCGAAGAAGCGTTTGAGCAAGATGC
AAGGCCTCTCGGACAAAGGTTGCCGAGACGTTAACAAGATTATGCACGTGGCCGAGAACCCGAGCATGCCGTACATTGGGCTCTACCTGCAGGGCTTCGT
CGGCCTGAACGAACTGCCAGTGTTTGAAAAGGCGGGCCTCATCAACTGCAGTCGGCTACGGAAACTGGGCGAGCTGGCAGTCGAGATTCTCCACCGACGC
TCAGTTGCCTACAACCTGTCATCGCACGACGCCGTCGAGTCGATTCTCCATGTGCAGCTGCCGTATCCGTCGGACGAGAGTCGGTATTCCAGGTCTTTGC
AGCTTGAACCTCGCGAAGCAGGCGCAGCGCCACTGGGCGGCCGCGCGACATTCGTACCGAACGATGATCTCGATCTCGAGAACGAAGTGCGCGAGTCGAT
CGGCTCTGAAGGAACATTTGGCATTCGGCAATGGTTCCGAATGCAAAAAGTGGTGCATCGCAATCGATCGCGATCAACGTCTCAGCAGGCCGCGTTCGAA
TGGGTGTGAAAGACGCTGTCCGCAGCGTTAACTTAATTGACTTCCTGTTGGGTTTCAACTTCAGGCGGGCATTTCGTTTTCCGCGACGTAGTGCGCTATA
CCCTCCATACATGCGAGGAGGTCGGCGAGGTCGGCATCAGCGTCTTGCGAGGTCTCAGAGTTGAGTGGAGACAAAGCCTTCTTGATGTCTTGACTACTGT
TCGTGCCGCCGTAGTCATCTCGCACAGCCTCTTCCATTTGATCCATGATGTGGTCGCCCTTGGCTGTCAGCATATAATCACCACTACGGGGCCTAGTCGT
GAGCACAAGTTGGCGATAGGTTTCCAGTGTAATTGGAACGTACAGCAAGCGATGCAGCTGAGCTTGCTCACGGGATCTCTCATCGAATCGTAAATGATCT
TTATACGCCTTCAAAGATACGAGTTGGTTAGAGCAAGTACCGGTTGTGATACTCCAATAGCTCGACTCGCCTCTTGCGATTGAGCGAGAAGGGACCCATA
AGTGTCAGATTGGCGTAGGAGACTTTCGTGTCGCACCATTTTGTGCACAGTGATCCGCTCGTGTTGCTGCTGCAGAGCCGAGAATTCCACCTCAGTTTGT
TTCCTGGGTGGCCAGCTTGCATGATCTGCTACGTGCGACAACACTTGAGTAATAAAGAATGGGGATACGGGTGAACGCTATCATGAGGATGCTTCTACGC
ACTCCTCATCGTCGGAGTCTCCATCCTCGTTGTCGCTGTCGAGAAAGAGCGAGNNNNNNNNNNTTTCTACGCACTCCTCGTCGTCAGAGTCTCCATCCTC
GTCGTCGCTGTCGAGAAAGAGCGAGTTGTTTGCCGAGCCACAGACTTTCCTTTCGCGGACGACACCACACGTCGCTTTCCAGTTCGGCTCTGAGGAGGCT
GGCAAAGGAAGGACACGTGAACTCCGAGGTTACNNNNNNNNNNTAGACGACACCATACGTCGCTTTCCAGTTCGGCGCTGAGGAGGCTGGCAAAGGAAAG
ACACGTGAACTCCGAGGTTACNNNNNNNNNNTCGAGCATTCCACCTCAATTTTTGTTTTCTCGGTGGCCAGCTTGCATGATCTGCTACGTGCGACAACAC
TTGAGTAATAAAGAATGGGGATACGGGTGAACGCTATCATGAGGATG