Description :
From Genome Similarity Track
Location :
Scaffold_1442:782- 2048
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1442-fgenesh-gene-0.0YALI0D09801p

Sequence
1266 bases(100 bases per row)
CCACAACGGCGAGCACCCAGCAGATGATGAGCTGCGTCAGAGGGTCCACCGACTCGGCGCCAATCTTCCACGACACAGCGGACATCGCGGACTGCACGGC
CTTGTAGAAGCCGGCGTAGTGTCCGAGCTCGTGAATGTCGTCGCTCATCTGGCCCATGATCCAGTACGCGATCAGCTGGCAGATAGCGTCGTTGAAGCCG
TAGTACATGTACAGCAGGAAGCGCGGCGTGAACTTGCCCGAGTCCTTGAAGTCCACCTTCTCCTCCGTCGACGTGTACGAAATGTCGTACTCGACCTGCG
CCACCGTGCCGAGGACCCACATGATGTTGACAAGCACGAACAGGATGACGAGCGCCACCTGTGCCTTCTTGCGCTTGGTCGCTCCGCCCGCGTCGAGGTA
CAAGCCGGCCAGGAAGGCGCCGAGCATCTGCGAGCCCCAGTAGAAGCCCGAGCTGAAACCCGTCGAGCGCGTGTTGAACAACGTCGAGTTGTACAGCGAA
TGGTACGTGTAGAACCAGTTCGAGTACGCGAAGAGAGGAAGCAGCAGCAGCATCTTGGGGCTCGCAAACTGCTTGAACACTTCGACGATCTCGACCTTCC
AGTCCGGCAGCGCTTCTACCTTGACCATCGTGCCGTCGTTGCGCACCACCTTCTCGGGGTCCGTCAGGAACATGGAGATGAACGCGCCGCACGCCATGAG
GATCAGGAACGCAATGTACGTGCCCGTAGACGTACCACCGGATGCGTCACTGTAGTTGGTGCCGAACGAGATGAAGCCGCCCATGGTCGCACCGAGGTTG
AAGATGACCCAGAAGATGGAGAAGTAGAGCCCCTTGCTGGCCTTGGTCGGATACGCCATGCACATCTGGCCCTGAGCCGTCCACAGCAGACCGGCGCACA
GCCCGAGGATCGCACAGGCGATCATAAAGAAGGCGCTGGCGCCGCCGTTGTACTTGACGACCGTGGCGCCCGTCGAATCGGTCGCCTCGTAGTTGTGGTG
CTTGAGGTAGAGCAGCGAGCCGGCGTAGAGCACGTAGCCCCAGGTGCCGATGAAGAGCGTGCGGCGAGGACCAATGTAGTTGACGAGCCCACCCGAGAGC
AGGCCCGAGACGGCAAAGCAGCCGTAGAGCACGCTGTTGCCATTGTAGGCGACCGTCACGTCTTGCATGCCCGCCGAGAAGGACGTGAGCGCGTTGAAGA
GCCCCGGACAGCAGAAGCACACGAACGACACGATGAGCACCTGGCCCAGCGCCGAGTTGCGCTGCA