Description :
From Genome Similarity Track
Location :
scaffold_286:782- 13384
Transcript NameFunction/comments
g6817.t1hypothetical protein

Sequence
12602 bases(100 bases per row)
TTTAGATCCAGCAGTGGCTAACGACCACTTGCTAACGTACGGGGTACTCGACTCGTCCGTGTTGTTGTCTGTTGAAACGCACCTCTCGCAGTTGTTTATG
CCTATGCTAACAGTGAGAGATGAGAGCGAGTGGGGACAAGCAGCAAGCGACGCGAGAAACGAGTTCATGTTGGGGTTAAAAAGCTTCGTGACGGATGTAC
AGGAGAACCTCAAGGCGATGAACACAGGTCTGGATCTACGTAAACCGGATAAAAAATACGATCCGTCGGATTCCAGAAGTTTATCCAAATTATCCACCGA
CGATGGAGCAGTGCAGCACTTCGTGGAGCTGATGAAGGACTGGTGTAAGCAGACAGAGGCGTACCTAGAAGATAACGACCAAGGGCGATGGGAATCCCAA
GAAGCAGGTCCAGCTACGGAGCTGGAGTATTGGAAAAGAAGACTACAAAGACTTATGGGTATAACCGAACAGCTCAAGACGAAAGAGTGCAAAATGGTCA
CTGGCGTTCTAATTGTGGTCTCGAAATTACAGGATGGAGTCATGGATAAGTTTGGAATTGCGTCGCTACTAAGACAGTGGAAGCAGATCGACACGAATAT
CACGGAAGCTTCGAATGAAGCGAAGGATAATGTCAAATATCTCGCGACACTGGAGCGCTTCATCGAGCCGTTGTATACTGGTACTCCGTCGTCAGTGGTA
GACGCTCTTCCAGCTCTAATGAACTCCGTCAAGATGATTCACACTATCGCTCGCTACTACAACACAACAGAGCGAATGACCAAGCTCTTCATGAAAATTA
CCAACCAGATGATCACCCTGTGCAAGAACAGCTTGGTCGGACGGGAGCCTGCTGAGGCTATATGGGAGAAAGACCCAGAAGCGCTACTTCTAGGTCTTGA
AGCCTGTTTAAAGCTTAACGAGGCTTATCAAGAGCAGTATCGCCTTACTAAAGACAAGCTGCTGACGATGCCAAAAGGAAAGCAGTTTGACTTCAGTGAG
ACGCAAATTTTCGGCAAGTTCGACCTGTTCTGTCGCCGATTGGTTAAGCTAATCGACATGTTCAGCACTATCCACCAGTTCCGAGCTTTGGCTCAGCATT
CGCTTGAAGGGATGGATGCCTTGCTGGCGTCTTTTAACACAATTATCCGGGAATTTCGCTCGCACAAGCACGACCTGCTGGATTTTCACAACAACAAATT
CGACCGGGACTATGTGGAATTTAACATTCAAATAGCAGATCTCGAGGCGTCACTGCAGCAATTTATCAACGTGAGTTTTGACTCCATCACTAGTATCGAG
CAATCTCTGCAGTTACTCAAGCAGTTCCAGCAGATCCTGCAGCGTGAGACGTTGCGCAGCGATTTAGACTCGAAATTCACGGTCATTTTCCACAATTACG
GGCTGGATTTATCTCACGTTCAAGAGCTGTACGAGCGGCACCGACATGATCCCCCCGTGGCTCGAAACCTGCCTCCTGTAGCTGGTAATATCCTCTGGTC
GCGTCATCTATTACGTCGGATTGAAGAGCCAATGCGGAAGTTTGAGAGTAACCCGACTGTTTTATCCACAAAAGATTCCAAGAAAATCATCAAGACGTAC
AACAAGGTAGCACGCACTCTGGTTGCCTTCGAGTATCTCTGGTACGAAGCGTGGTGCCGTTCGGTCGAAAGTGCACGAGCTGGACTACATGCTACTCTGA
TTATCCGACATCCGGAAACCGGCAGACTTTTTGTGAATTTTGACAAAGAGATTTTACAGTTAATTCGAGAAGCTCGATGTCTGGATCGCATGGGGATTGA
AGTACCGGAGAACGCACGTATGGTCATGCTACAGGAGGATAAATTCAAGGCCTATTACAACGATTTAAGCTATGCGCTTCACGAATACGACCGTGTAACT
GCGAAAATCATCCCAGTTACAGCTGTTCTACTACGTCCTCACTTGGAAGATCTTCAGCAGAAACTTCGACCTGGACTGGTCACTCTTACGTGGACCAGTA
TGAACATTGACGCGTATACTGCAGTAGCTCATGCTGCCTTACAACGACTGGAAGAGCTCATTTCCAGCGTTTTAGATGCTATCGAGAACCGGATTGAGAA
GAATTTGGTAATTGTTTCCAAGGCTTCACTGGTGAATTTACCTACCGATCAGTCTTTTGCTCTGGATGATTTCGTCCGGATGCAGGAGAAGCACGTGGCA
AATGTTACGAGACAATTGGCAGCCAAGAACGTGGAGATTGAAAATGCTGTGGAAGATGTACTACGACTCATCTGTGAGTACCATCTTGATGGTACTCCCT
CAACAGTAAATGGTGCTTCAACGTCAGGAACTGTAACGTGTGATGTTGAAGCGATGGAAACGTTCCGAAGTTTCTACCGGAATCTCTTCTACCGTTCCTT
AGTTACGTGCACCAAGCAATCGTTAGATGCCATTAAGAAACGTGTATGTTCCAAGGCTGGCACGGGTTTTCTCTTCTTGGAGCGACCGTTTTTCGAAGTG
GACGTGCAATTATCCGTGCCTTCTGTTCGATTAAGTCCATCGCTGGATGATATCCAGAAAGCTATTAACCGATCCGCTGTTGCTGTCTTACGCTGCTCGA
AAAGTCTGTATGAATGGGGACAACAGAGCGTTTATCCGGAAACAGCGCGTACAAGTTTATTCGAACGCCTTGGCTGCGATACGGAAATCATTAAAGTGGC
GATTTTACTTACTGGAGCACTTCATGGCACGAAAAACCAAGTTCACGAGTATCTTTCAGCTTTTAAAAAGTACGATTGGCTCTGGAAAGAAGACATGGAG
TTCCGGTACAACCAGTTCATGCAGAGAAACCCTTTAATCCAGGATTTCGAGACGGAATTACGTCATTTTATGGCTGTTGAAGCGGAGATTTCTCTGATTG
CGCCTGTACACAACATCGCGGTGTTATCTCTCAACACGAAGAACCTGAAGCTGCAGTTAAGGAATGAATGTCGTCAATGGAAAGTTCAATACTCGGATAA
AGTCCATCAACAGGCTCGAACTGCACTGTTTAACTTAACTGATTACATCCGAACCACAACGTCCAAGCTTAGTACACGAGTAGAATCTCTCGATGCTCTT
CGATTCGTTATGGGAGTTTTAAAAGAAGTGAGAGAGCGAGAGTCTGCGATTGAGATGGAGCTCAACCCGATCGCAGATATGTACGATATGCTCGAGCATT
TCCTGCCTGGAGGTTACATGGATAAAGAGGAAATGGACCAGAAGAGTGTTCTACGAGGATCGTGGAGGAAACTCGTGGATTATGCGGAAGAAGTGACGGA
TAATCTGTCCGAAGTACAAGGAGGATTCAAGAAGCAGTTGGTTAAAGATGTGAAGGATTTCCAAGCGGATGTTTCAGTATTTCGAAGCGAATACGAAGCG
ATTGGTCCAATGGTCTCTGGTCTCGAACCTGCGGAGGCTGTGGAACGTCTGAAACGATTTAAAGACCTTCTTGGGATCCGAGAGCGGAAATTAGAGGTAT
TTTCAGCCGGAGAGGAGCTTTTCGGGATGCGGCCGACCGAATATCCTGAAATTGTGCGAACTCGTAAAGAAATGGCACTACTGGATCAGCTTTACGGCCT
CTATATGGACGTGGACAAGATAATGGATGAGTTTCGAAGTATTTCGTGGTCACAAGTGGGGGTTAATGTCGAACGGATGAGTGATTGCTTCGCTGGTTAC
GACCAGAGATGTAAGAAAATGCCCAAAAATTTGTGTGAGTGGGAAGCGTACGGTATTTTACGGAAAGTTATCGCCGAGTTTCTGGAAATGTTACCAATTG
TGCGAGAATTAACCAGGGAAAGTATCAAACCTCGACACTGGGAAGAACTCATCAAGGCTTGCAATGGCCAGCGACTACCGTATGACAGTGAATCGTTCAA
GTTCCAGGACGTTCTTGACGCGAAGCTTCTCACTTGGAAAGAAGACGTCGAGTACATTTGTGAAAGTGCACAGAAACAGCTGCAGATTGAGCACAAGCTT
CGAGACCTCACAGATCGTTGGGCTGGTACAGCGTTCGAGTTTAGCGAGTGGAGACAACGCAATGTGCCTGTGCTAAAAGGTTACGGTCAGATTATCGAGG
ATCTCGAAGAAGGTCAGCTCCAGCTCCAAGCCATTTTAAGTATGAGGCACGTGGTATTTTTCAAGGACCGAGTACAAGCGAAACTCGCGCAACTTTCAGA
TACAGCCGATGTGCTTGAACTCTGGGCGAAAGTCCAAACGCTGTGGATGTCACTGGAATCGGTTTTCACAGGTGGAGATATCGCGAAACAAATGCCACTG
GAAGCGAAAAAATTCGCGAAAATCGATAAAGATTGGCTCAAAGTCATGAGTAAAGCGTCGGAAGTAGGCTTTGTCGTGTCTTGCTGCTCGAATGAGCTAC
TGCGCAGCACGCTCCCGTCTCTTTTCGGTGAACTGGAGAAATGCCAAAAGTCGTTGGAAGGGTATCTCGAGCAGAAACGGAAGAAGTTCCCTCGGTTTTA
CTTCGTGTCGAACCCTCTTTTACTGCAGATTCTCTCTCGAGGATCGGACCCAGCAGCTGTACAGCAATACTACGAGAAAATCTTCGACAGTATCAGTAAA
GTAGTACACGAACGCCCAATGACTGCAGACTCTAAAGCTCCAGCTACAACGAACCCAAATTCTAAGCGGAAGATCGTCGAGATTAAATCTCTGGTTGGAA
ATGATGAGGAAACGATCTCTTTAGTTCAACCGGTTCTCCCTGATGGGAATATTGAAGATTGGCTAGGGATGTTGGAGAAGGAAATGAGACGTACACTCAA
GACTTTGTGTCGTCAAGCTGCTGCTGAGTGTTCGTCGGGCTCTTTACGTGAATTCGTGAGTAAAACGTGTGCGCAGTTTGCTTTACTTGGGATTCAGTTG
AGTTGGACTACAGAATGTCAAGACGCACTGCAGAGATGTCGAACAACTAAAGGGATTATGGCTCAGACTGCAAAGAAACATGGAACGATGCTTTCCGAGC
TGTCTTCCTGGTGTTTAACGGATCTCGGGACGAAACTTACGCGTACTAAAGTGGAGACGTTGATTACTATTCAAGTACACCAGCGTGACTGTTTCCTGGA
ACTTTGTCGCCTCTACAAGGAGAAGAAACTATCGGATTCCAATGACTTTGAGTGGCTGAAACAAGCTCGATTCTACTGGCGTGTTGGAAGCCAAGGAGCC
TCCGATTCGGTGGGTCCTGATGCCTGTTTGATCTCCATTTGTGACGTGGATTTTAAGTACGCTTTCGAGTATTTAGGCTGCAAGGAACGGCTAGTGATCA
CACCTTTGACAGATAGAGCGTACATCACTCTGTCTCAAGCTTTAGGAATGTATCTAGGTGGAGCACCCGCTGGACCTGCAGGTACCGGTAAAACGGAGAC
GGTTAAAGATCTCGGTCGCAGTCTTGGAGTCTACGTGATCGTCACGAATTGCACCGATCAACAACGGTATTCCGATATGGCGAAGATCTTTAAAGGACTG
TGTCAAGGCGGACTTTGGGGCTGTTTCGATGAGTTTAACCGCATCGAATTACCGGTTCTTTCCGTGGTAGCGCAACAAGTTTTAGCCATCACAAATGCCA
AGAGAGTGCAAGCTTCCACGTTCACTTTCCCCGGCGACCCATTGCCAATCGGGCTCCATACGGATTCCGCTTACTTCATCACGATGAATCCAGGGTATCA
AGGACGACAGGAGTTACCTGAAAACCTAAAGGCTCTCTTCCGTGGAGTCTCTATGATGGTGCCAGATCGTGAAATTATCATGAAAGTGAGACTTTGTGCG
GTGGGATACGACGCTTTTGCCGAACTTGCACGTAAATTCAAGACGCTGTATGCTGTTTGTGAGGGTCAATTGTCCAAACAGCGCCACTATGACTTCGGCT
TGAGGAATATCCTATCTGTTCTGCGATCTGCGGGAGCTACCAAGCGTGATAACTTACTGGCAAGTGAAGAATTGCTACTGATGACGACGTTGAGGGATAT
GAATCTTTCGAAGCTTGTGGCTGCTGATGTTCCTATCTTTTTATCTCTCCTTCGAGATATTTTCCCTGGCGTGGAGCCATCACCTTCTGTAGGGAATAGC
ATTAGCGAAATCGCCGGAGCGATTGAAGATGTACTGCAAAAGACCCAAAGCTGGCCCCCTCCAGCTACTTGGAGTGCTAAAGTTACGCAATTATACGAGA
CGCAGCTTGTCCGCCATGGAATTGCGCTTGTAGGTCCTGCGGGGTCCGGAAAATCCGAGATTTTACGGACATTACAGACGGCGTTGGGTTTTTCCACTCG
AACCCCACACAGACAAGTGCGTTTAAACCCCAAAGCCGTTCGCGCGGAAGAATTATTCGGAGAGACCGACAGATTATCCGGGGAATGGGTCGACGGAGTG
TTTGCAGCCATTTGGGCTAAGTATAATGACCGAAGTCGTAAAGATGTGGCTTGGTTGGTCTGTGACGGCCCCGTCGACGCCGTGTGGATTGAGAATTTAA
ACACTGTACTGGATGATAACAAGCTGTTAACGTTAGCCAACGGTGATCGTCTACCCATGACGGATAACTGTAAACTCGTGTTTGAAGTCGAAGATTTACG
AAACGCTTCACCCGCGACAGTCTCAAGGGCGGGAATTGTGTACGTGAGTGATACGGATCTCGACTGGGAGCCTGTGGCTCAACGCTGGCTTCGTTTGCGA
TCGGAAATACAGCGAAAAGCTTTATCTCGAAGTCTACGGACACTGGTGGGAGGAGAAACGCCAGGTTCTGGACATTTATTTGAGTTTTTGAGTCGAAGAT
GCCGTCCAGTGATGAATGCACCACGTGTAGCTCTGATTCAGTCGTGCTTTAACCTCTTACAAGCTCTCATGGATCGCAGTGAATTGAGCGAGAATGTCGG
TGATATGGAGCTGGAACTGGAAAGATTGTTCGCTTTCTCGCTGGCTTGGGCGATAGGAGGGGTGTTAGATCTCGAAGACCGCGTGAAATTGCACTTTTAT
TTAGGTGAAAAGAGTCCCGCGAGCTTCCCACCGGCAACTATTGAGGCAAATGACCAAAAGACTGGGTCAAATAGTGTAAATTTGACCATTTTCGACCATT
TCCTGCATCCGTCGACGCTCGAATGGGAAAAATGGACACTGGATACCTGTGAAAACCTATTGACACGTACCACTGGAGTGGTGAATGTTGGTCGTCTAAT
TATCCCCACAACGGATACTGCTCGAGCCTTGCATTTACTGGAGCACCTTCACGCCAGTCATTTACCTGTTCTACTTGTAGGTGAGCCTGGCACTGGTAAA
TCCACACTTGCTCGTCTATTTTTCGAGACTGGTGGCTCTAATTCGGAAGGAATTGCGTCGAGAACATTAATTTTCGCAGGATCGACACTAGGAGGAGCTT
TCCAGGCCACAGTCGAAGGAGAATTAGAGAAACGAGGTGGAAAAACGTATGGACCTTCCAACGGACAACTTCTGACGTTGTTTATGGACGATCTGTCCAT
GCCAGCGCTGAATGAGTGGGGAGATCAACCTACGCTCGAAGTTGTACGTCAATTGGTGGAAACTCGGACGCTCTGCTTCCTAGATAAGGACAAACGTGGG
GATATTAAGGTCATTGAAGGTTTGCGCTTCCTAGCGGCTATGGGGATCCCAAGAGCGGGGAAAAATGACGCCCCGGCACGACTTAAACGGCATTTCTTCA
TCTTAAACCTGTTACCTGCTTCTCCCGAAGTGGCAGAGTCCATTTTCGCACAATTAATGCGTTGGAAATTCGTTCCTGAGCTGGAAACAGACTCCAGTAG
CTCTACGACTGCTAAGAAACCTTTAGTGGAGTTGATTTCCCGTCTTGCAGCTTCGTCAGTGCAGCTTTGGCACTGGTTACGTCGCTCGATGCCTCCTACG
CCGCAGAAATTCCACTACGTCTTCAGTCTTCGTGAACTCAGTCGCTGTTTCCAAGGAGTACTACGTATTCCTGTTGAAAGTGTCGCGCTGAGTCCTGATA
AAGCTCTGGTTCGACTGTGGCAGCATGAACACATGCGCGTATTTGGAGACCGATTAGTCTCATTGGAAGATAAACAACGCTTTCGGGATGAATTGACCGC
TGTGACGGAAGGATTGATGGTAAAGTCGAGTGGAACGGCGAGTGGCTTGGTATCCAGTGGCTCAAGTAAAGAGAAACCCTCCACCGGTACGTCTGATGGC
CATAGCTTACAGAATAACTTGCACCACTTCTCACGTCAAAATTCTGTACGGTCAGCTTTCACTACATGGCAAGGGCAGATCTACGTCGATTTCTTACAAG
ACCAACCGCAGGACGAGTTCGGAGAACCCGTCGGGGAATTCCCTCGAGTTTATGAACCAGTAGCGAGTTTATCGGCTTTTCGGACTCGAGTTGAGAACCT
TTTAGCTCATTTTAACCGGGAAAACCCGGCACGAGCCCTACCCAGTCTCATCCTGTTCGAGGAAGCGTTATCCCATTTAGCACGATTAACTCGTGTGCTT
GGACTGGCTCAAAGTAACATGATGCTGGTAGGCGTGGGTGGATCGGGGAAACAGTCTTTGGCTCGACTTGCAGCTGCACTTAGTGGTCATGAACTCTGTC
AGTTATCGGTCACGAAAGCCTACACTCTTGCAGCTTTTCTTGACGATTTACGTGGACTATGTAAGACTGCTGGACAAGTTGGAAAGGGGATGGTTTTCTT
ACTTACCGAAGCGGATATCAAAGACGATTCGTTTCTGGAACAAGTGAACGCTCTGTTAGCTACTGGAGAAATCCCTGGTCTCTTCCCCAGGGATGAATTG
GTCGCAATGGCGAGTGAACTACGTGGAGTCATGCAACGGGAATGTCCAGATCGAGCTGATACGTTACCAAACCTTACTCGTTTCTTCCACGATCGTGTTC
GAAGAAATCTACACATTGTTTTGTGTCTTTCGCCCGTAAGTTCGCGCTTTGCAGACCGTTGCCGGGAATTCCCGCATTTAGTGAATGGCTGTACGATCGA
CTGGTTCTTACCGTGGCCTGAGGAAGCTCTTACTGCTGTAAGTCAGGGTTATCTCGAGAAATTCGTACTTGAGACGCCTCCAGCAACAAAAGATGCGTTG
ATACTGCAAATGGGACGAATGCATCAAGCAGTGGAGAAGGTTAGTGGTGAGTATTTCACACGACGCAGACGACGCGTTGTCCAGACGCCTCGCAGCTTTT
TGAGTTTCCTTGCGACGTACAAAGAACTTTACGGAGAGAAATTGAGTAAAGTGCGACATCAGGAAGGCGCCGTGAACTTGGGACTGCAGAAATTAGGCCA
AGGAGCGCAGGATGTGGAGAAAATGAAGGTCGTTTTAAAGGATGAGGAGGCCAAACTGGTGGTAGCGGAAGCAGCAGCCAATAAAATGCTGGAAACTCTA
CAAGTTAAGTCCCTGGAAGCCAAAAAAGAGAACGATATCGTACAGCAAATACGGGAACAATGTTTGGCCGATGCTGCGATGATTTTAGCCGAGAAAGAAG
CAGCCGAAGAGGATCTCAAACGTGCTCAGCCGTTCCTGGATGAAGCCGAAAGAGCAGCGAGCAGTATTCGCCCCAATGACTTGAACGAACTAAAGAAATT
GGCGAAACCGGGAGATATCATCAAATTAATTTTTGATTGTGTGGCGATTCTTCAAATGGCCCCGTTGCTTAAAGTGGAGCGTGCCTCTGTGACAATGGGC
GTTGGTAAGGAGAAACACACGTGCGATTTCCTTCTAGACTCGTTCCAGATCGCTAAATCTGGGATGTTAGCCGATACGAGGTTTTTACAAAACATTTTCT
ACTTTTCCAAGCACCAAAAGGACCAGATGAACGATGAAACGCTGGAATTTATGGCTCCGTATATGGATCTCGCTGGTTTCAGTGCTCCAGTGGCGAAGAA
TGCGTCCAAAGCAGCAGAAGGGTTATTCTGTTGGGTTAAAGCCATGAGCATGTACCATGAAGCCTCCAAAGTGGTTAAACCGAAACTGGAAGCGCTTCGT
ATTGCAGAAGGGAAGTTTGAAGCAGCTCAAACTCGTCTCCAGAGCTCGGAAGAGAAGCTTCAAAAGTGCCAGAACGTGCTAAATCGTTTACAGGAGGATT
TCCAGACGCAAATGGCGGAAAAAGCACGAGTTGAAGCGTTCGCACTAGCGACAAAGCGGAAAATGGAGCAAGCTACGGCATTAATTGGTGGACTCGGAGG
GGAAAAACTTCGGTGGACGGAAGATTCGAACCGATTCGTGGAGAGGAAGCAACATCTCGTTGGAGATTGTGCTCTGGCTGCGGCTTTCTTGTGTTATTGC
GGACCTTTTAACCGCGAATATCGAGATTTACTGTTACGGGAGCGTCTTCCCTTTGAATTAGGAGCTGGAGCCCCTCCTAGTAGTAGTACTAGTCCGGTGA
AACCTCCGTACTCAATTCCTCTTACTCGTGGACTCGCGCTGGAGGAATTTCTGGCTGATGCGGGATCAGTTAGTGACTGGAAGTTACAGGGTTTACCGTC
AGACCCTCTATCTATTCAAAATGGAATGTTGGTGGCTAGAGCACCTCGGTTTCCACTGCTAATAGACCCACAAGGCCAAGCTTTATCGTGGGTTCTTCGT
CGAGAAGCTGAACGGCTGCCTTCTGTGGGGGTTCTTTCAGTCAGCAGTCCTAAACTTCGAGAAATTCTGGAACATTGTGTGGGTGAAGGGAAAGCTCTGA
TTCTAGATGGAGTTGACGGTGCAGATCCAGATCCTCTAATGGCGAATGTATTGGATAAAAACTTTATCGTCCGTGCTAAGGGGAGGTTCGTGAAGATCAT
GGATCGAGTGTGTGAATATCACGAAGAATTCGCTTTATACCTGACAACTCGCGTGCCAAACCCCCACTTTTCGCCGGAATTGCAGGCCCGAACACTTGTC
GTGGACTTCACAGTGACTCAACGAGGTCTAGAGGAGCAACTTCTCGCTCAGGTCATTCGTCAGGAGCAACGTTCGCTTGAAGAACAGTTGGAACGCGTTC
AATGTGAACTGAACGCAAATGCGAAGGCGCTGGTGGCTCTGGATGCACTGTTACTCGAACGCCTTTCAGCCAGTAAAGCCAATTTATTGGACGACGTTGA
ACTCGTGTCCGTCTTGGCGAATACAAAAGCGAAAGGTACTGAAGTGAACGATAAAATCCTCGCAGCAGAGGAAGTAAAACGAGGTATCGACGAAAAACGG
GAACATTATCGCCCCGTAGCTGCCCGAGGCTCCGTGCTGTACTTCGGTATCGTGGATTTCGCAGTTGTGAACGCCATGTACCAAACGTCTCTGGATCAGT
TTTTGCTGCTCTTTGTGCGCGCTATTGAGGAAGCAGAGCGATCTGCTCTCGCGTCGAAACGTGTGACGTATATACTCGAAACGCTGACGTATATCGTCTT
CCGGTACGTGAATCGAGGGTTGTACGACCGTCATCGCCTCAGTTTCCTGCTTATGATAGCACTCAAGATCCTCGTAGCTGCTGATTGTGTGTCTGCAGCT
GATGTGACGCTTTTCCTTAAGGCTGGAGCTTCTCGAAAATTGTCAAGTGACCAACCGAAGCCGTTCGGATGGATGTCGACTGGAGCGTGGCTCAATGCCG
TGCAGCTTTCTAGTGATAAACCACACTTCCGGAACCTTCTTGGTGATTTGGAACGCAGTGAAAGTGCGTGGCGTAAATGGTTTGAAGATAATGAACCGGA
ACGTCTGGCTGTACCGGACTATGAAGGTCTTCTATTCGACCCACGAGCTATCACGGCGAATCTCCACTTCCATCGACTGCTTTTGGTCCGTTCTTTGCGT
GAAGACCGCACGATTCCAGCCGTTATGGATTTTATCCGTGCGATTGAGTTGATTGAAGGTGCAGTTGGGGTTAGTTTGTCTCGGCTTCCAGCACTAGGTC
CTCGATACGTGGAGCCCATCACAGATACAGTGGAGAGTGTGTATCAAGAGATGCGGGCGGAAACTTCCGTTCTGTACTTGCTTTCCCCTGGAGCAGACCC
GACGGAATCAATTGAGCAACTTGCACGACGAAAACGTCAAAGCGTGACGACGATTTCAATGGGAGAAGGTCAGGAAGCGGTGGCTGCACGTACCGTAGCT
TCTGCGATGCTGAATGGGGCGTGGGTTCTGCTCCAGAACTGCCATCTTGGGCTAAATTACATGGATTCACTATGTGAAGCTCTTACAGTTGCGAACGGAG
GAGGAGCGGGCAGTTCCAGTACGGTGCCTACACGAGCACCGGAATTCCGGTTGTTCTTAACGTCCGAGCCACATCCGGATTTCCCTATTGCATTGTTACA
TTGCAGTACGAAGGTGACGAACGAACCTCCCGCTGGTCTTCGAGCTGGTTTACTACGCAGTTTCACGGTATTAGTAGACCAGGACAAGCTCGACCGTCTT
GAAAGTCCGTCCTGGCGTTCTCTACTCTTTACGGTCTGTTTCTTACACGCAGTTGTGGTAGAACGACGGAAATTTGGTCCTTTGGGCTTCAGTGTGCCGT
ACGAATTCAACGCGGGAGATATGGGCGCGTCCTTGAGCTTTTTGGAGCGGCATTTGTACACTTCTCCGTCTCCGTCGTGGCCCACAGTGCAGTATATGGT
GG