Description :
From Genome Similarity Track
Location :
contig_100:78196- 79324
Sequence
1128 bases(100 bases per row)
TCGCAAATCCACGTAAGTTTTGAGTGCTGATGGTTAAGTTGGTTCGAGGTCCTAGTTTGTGTCGTCGTGTTACTGGTGGTTGTTCAAATAAAGTAGCTAT
GTTGTGTAGGTCACTGTAGTAGTCTCCTTCCGGAGGGTTGTTGTTCGGTAGCTGATTCATGGTTATTGTTGCCCTGTCGCTTTCTGGAATAATCTCGACT
CTGTTGGGAGATGTGAGCAGTTCTTCGATCTTGGCCCATACCCCAGCTGTATCCTGTTGGTGGATAGTTGCGTTAATATCTGCATTCTCTTGCATGACCT
CAAAGAGTATGTCGAGGTACTCAATTGTGGTCGTGGGTTGTCGGCCTCCAAAATTCCTAGTTAATCTCTGAGTTCATTGGTGTACACATGTGCTGCTACA
ATAATTCTCGACAGATATTTCAGTCGTCCCTTACTGCAGAGTTTGAGTAATTCCATGTCTCCACATTTCATCAGTTTCAGTTTCTTCCATAGTTCAGTCG
GGAATAGGTTGAGTTGTTCTTGATTTAGCGCTGCTTGTTGCTGCAGTTCTCCAATACATAACTCCAGCCAGTTTGTGCTGGCGCTGTCTCCTGTTTCACC
AGCTTTTTCCGCCAGTTGACCCAGACAGTGAATCAGGCAGTCCAAGCGAGCCGCTGTAGTCCAAGAATCCAGTACTGCGTCTGTCATCGTTGAGAGTATG
AACTCTGGAGATTGATACTTTCTAAGCGTTGATAGCAAAGTCCCTGGAGCATGCGTCACTACCGATTTCCATGTCTCCGTTGTTGCTGGTAGTGTAGGGA
ATGCTGTTGTGGTCTCCTGTTCCCACTTCGGTGCTTCTTTGTGCCACAGCTTCCGTAGTTCTCTTTGGCGAGCCCTACTAGCACCGATGGTAGTATAGTT
GGTTTCAAAGCGGCTTGGATGTGGGTTTGTTGTGCTGTCTGCCTCTGTGGCGCTCTCGTCTGGTAGAATTTCTGGGTCGTCTTGTTCCCAGACCGAGCTG
CTTGAATGGGGTCGCTGGACGAAGTAAAAGTAGATGATGGTCCTTTATCCAGTAGTTCATCTTGCCATTGTTTTAGCGTTGTTTGATCTACGTCGTACCG
TTTCATCCATTCTTGCACTGCTGCTTCA