Description :
From Genome Similarity Track
Location :
scaffold_25:781892- 784738
Transcript NameFunction/comments
g2954.t1 hypothetical protein PHYSODRAFT_300538

Sequence
2846 bases(100 bases per row)
GCAAGTCGCGTCGCTCCGACGGCTTCTCCCGTCGCCGGCGCCGCGCCAATAGCGACGAGGACTTGGCCTCTGCTTCCCAAGACGCCGAACATGACTCCGA
TGTCGAGATTGTGCGCGATTTCAGTTCCAAGCGCGCGCTAGAAGCCGATCCAGACGCCTCCCAAGTGTCCCCGGAGGAGCGCGAGCGATTACGCGACCGC
GAGGAGCGCGACGCATTCGCCGAGCGATTGCGTCAACGGGACGAGGACCGCACGAGGCGCAAACGCAAGGCGGAGGAGCTGGAGGTTGCCGGGGGGCTCA
CGGGTGACGAAATCCAGCAGCTGGCCAAGAGAGGAGCCGTAAACGACGACCAGAGCGCGCTCAGCGACAAGCTGCAGCGCCTGAGAGAGCTCAGCAGACA
GGAGTACCTTAAAAAGAGGGAGGAGAAGGAGCTGGAGCTGTTGGAATTCCAGCTCAAGGACGAGGACGTGCTCTTTGAGGACGGCAAGAGGTCCAGGAAG
GAGCAGCAGCAGCTGGAGCTCAACAAGAGGATCCTGGAGACTGCTAAAGCTAGGTCCCAGAAGGAGGAGGTTGACGGGTATCAGATCCCAGACTCGTACG
AAGAAGTGGACGATGAAGGCAACAGGATCAGGAAGAAGGAGGACTTGTTGACGGACAGATACGAGGAGGAGGAAGTGGTCCATACAGAGCAGGAGGTGTG
GGAGGACACGCAGGTCAAGATGGCAACGAGCAGGTTCGGGGTTAAGGAGAGACACAGGGAAAAGAAGGAGGAGGACGAGTTCGTGTTCGACGACCAGATC
GACTTCATCTCGCAGCAGATGCTGTCGGGCCATCATGTGAGTGAGGAAGACGTCCAAGAGGCGAGGAAGAAGATGGAGCAGGCGAAACACTTGAGTATCC
AGGAAGGAAGGAAGCAGCTGCCCGTGTATCCTTATCGGGAGTCACTGCTGGAGGCGATTCGGAATTACCCCGTGATTATTATTGAGGGGGAGACTGGGTC
AGGCAAGACGACACAGATCCCGCAGTTTCTGCATGAGGTCGGGTACTCGGAGCTCGGTATTATTGGGTGCACGCAGCCCCGACGTGTCGCTGCGATGAGT
GTGGCAGCTCGTGTGGCGCAGGAGATGGATGTGAAGCTGGGTAACGAAGTGGGCTACTCTATCCGTTTCGAGGACTGTACCAGTGACAAGACGGTGATCA
AGTACATGACAGATGGTATGCTGCTGCGTGAGTTCCTGACCGAGCCTGATTTGAAGACCTACAGCGTCATGATCATTGATGAGGCTCACGAACGTACTCT
CAGCACGGATATCTTGTTCGGCCTGATCAAGGATATTGCGCGTTTCCGAGACGATATCAAGATCATTGTGGCCAGTGCGACGCTGGATGCGACCAAGTTC
AGCGCCTACTTCGACGACGCCCCAATTTTCAAGATCCCTGGACGCATGTTTCCTGTGGATATTCTGTACACGAAGGCTCCGGAGGCAGACTACCTGGATG
CGGCTATCGTGACGGTGCTGCAGATCCATATCACGCAGCCTCTGGGAGACATCCTCGTGTTCTTTACCGGTCAAGAGGAGATTGAATCAGCTGAAGAGAT
ATTATTGCAGCGCACCCGTGGTCTTGGCTCGCGAATAGGCGAGCTGCTTATTCGACCAATTTATGCGACGTTGCCGTCGGAACGCCAGGCCCAGGTGTTT
GAACCAACGCCTGAGGGCGCTCGCAAAGTGGTGCTGAGTACGAATATTGCTGAAACATCGCTGACCATCGCGGGAATCTGCTACGTGATTGACACGGGCT
TTTGCAAACAGACCAACTACAACGCGCAGACGGGCATGGAGTCCTTGCTGGTGGCTCCAGTGTCGCAGGCTATGGCGAACCAGCGAGCCGGTCGCGCAGG
CCGTACCGCTCCGGGCAAGTGTTTCCGTCTTTACACGGCGTGGTCCTACAAGAACGAACTTGACGAGAACACAGTGCCGGAAATCCAGCGTACGAACCTC
GCCAGTGTTGTGCTGCTCATGAAGTCACTCGGAATTAACGACTTGCTGCACTTCGACTTCATGGATCCGCCGCCAGAGAAGGCGCTCATTCGCTCTCTTG
AACAGCTCTACGCCCTCGGCGCCCTGAACGGTTTGGGTGAGCTGACAAAGCTCGGACGTCGTATGGCTGAGTTCCCGCTGGACCCGATGATGTCGAAGGC
TCTACTCGCCTCAGAGAAGTTTGGCTGCACCGAGGAAGTGATGACTATCTGCGCCATGCTGAGTGTGAACAACTCGATCTTCTACCGACCGAAGGACAAG
GCCGTTCACGCTGATAATGCGCGACTCAACTTTGCACGTGGCGGCGGCGGCGACCACATCACGCTGATGAATGTCTACAACCAGTGGGTTGAAACGAACT
ACTCGACGCAATGGACGTACGAGAACTTTGTGATCATGCGCTCGCTCAAGACCGCCCGCGACGTGCGAGAGCAGCTCGAGGGCCTTTGCGACCGCGTGGA
GCTCGAGAAAACGAGCAACCGCAGCGACCACGAACCGATCCGCAAGGCGGTCTGCGCAGGGTACTTCTACAACACGGCCAAGCTGGACAACTCGGGGCAC
TACAAGACGGTCAAGAAGGCGCAATCTGTGCACATCCACCCGAGCTCGTGTCTGATCAAGCTCGAGGAAGTCCCGCGGTGGGTCGTGTACCACGAGCTGG
CCTTCACGACCAAGGAGTACATGCGCAGCGTGATCCCCATCAAGTCCGAGTGGCTCATGGAGCTCGCGCCGCACTATTACAAAACCAAGGAAGTCGAGGA
CGCCCGCACCAAGAAGATGCCCAAGGCTGTCGGTCGAGCAGGCTAA