Description :
From Genome Similarity Track
Location :
Scaffold_123:78189- 85943
Sequence
7754 bases(100 bases per row)
GTTTTTGTCAGCACGTGCGGTTGTCCTGCCAGTGGGGTCGAAAGTAAGTTTTGGGCGTGCATGTTGCCTTGAAAGTCCACCTTTTGCTGCGCAAGCAGCT
CCACGTGTAGCCGCGCCAAATAGTCAGCATGGGTGGGAACAGGTTTGCCTTGCTCTTTCATCACTAACTTGTGGATAATGAACCCATTGACTAATGCCAT
GTCAACGATACCGAAAAACAGGTTCTTGTAGTAGGATCGATGGCGCAGTGCTTTCTGGATAGAATAGCGGTGAAGTCGCAGCTGATCGTGTTGGTCTACT
CCTCCCATGCCTTTGTTGTAGATACGAACCAGCTCGGGGCACGCAACTTCAAGAGAGACGCCATCCCCCTTACGCTTTCGCTGAACAATAACCCGTCTCG
TGCTGCATCCCGTTGCCATGAAGTTGACGATCTTTGAATCCTTCCAGCTAGCGGCGACCAACCCTGGGATCCGTGGATTATACGCGACACGGTACGCTCC
GCGCTCAATTTTGTTTGCAGGTTGCTGAGGTTGCAACTGCTTTTGCTTTTTCTTACTGGGGTGTAGATAGCGCGTGATCTCCTCAAATCGCTTGCGAGTT
TTGAATTTGCCGAACGTGCCTCGTGGAATTGCCCCATTCTCAGACGTCGACCAGTGATCTCCTAGTGAACGCCGGTGGGCGCACAGTGCACGAGCTATAA
GCAGTGCAATGTAGTGAACTATCTCGTGAGCTTGAAAGGGTTTCACCTTGCTCAAAGTGTCTTTGATATCCGATAACGACTGGACTCGACTATCTGGGTG
TGTAAGTTGCCACTGTTGCTGACGGCGCTGCTTCTGGATAGCGACTTCATCTACCACACTCGCACGATATCGATTGGATTCCTCAGCAATTTTGGTCCAC
ATCAACTTCGGCATGAAGTAGTAAAACATGGCAAGAGGTGACTCCGCATACGTTCGCGCAGACTCCGTTGGGCCCCACCGGCCATTGTACAGATCCGATG
CACCATCTACTTGCAGGTCTCCACTGTGGTCTTGATCGTATACAACCCACGCAGAAGAAACCGCCTTCAATTCCGCGTCACGGAGAAAATCAGGATTGGC
ATTGGCATTTTCTCGAGGGGACCAGTCATCATCAGCAACATCCTCGAAGAATTCGGCGTCATCTTATCCGTCATCGTTGTCGCTCAGAGCATCCTCGGCG
GCATTACTTGCCAAGCCCACTTCCGTGTCCATTACTTCGTGAATATAATCTTCCGTATCAATCTCATCAGACTTGTCGCTCTCCGAGTCCGAGTCACAGA
GATTGGAATCGTCTGCATCCGCATTTTGAGACCATTCACACTTGGACAAATCGAAAATGAATCCATTCGAATCGTGCATGTTGAACTCTGCAACGTCTTC
AAGCTCGGGCTCCTCACCTTTTTCCTCTTCCTCTACTGCAGCATGACCTTCTGCTGTATCAAGATGCAGAGGCAGCGTCATTGTGTTTTCTTCTGCTGTA
TCAGACAGGATAACACTCGAAGCTTGTGCTGTAGAAGCCAGAGTAACAGGGACGCACAGTCAGAGCTTGTACAGTAGCATCCCGAGTAGCCACACTCGCA
GTCCGAACTTGTGCTGTAGCCGGTCGAGCAGCTGCGGTCGAGGGCCGAGCTTGTGCTGTATTAGCCGAAGTAACTGGACTCGAAGCCCGAGCTTGAATTG
TACTGGCTACAGTGATTGCCGTCGCAGTAGAGGTCGTCGTAGCTGGGCACGTTCTCTTTAGCAGGCAGAGGTAGTCGTTGGTGCTTGTCTCCCTTTGCGA
CGCGATCAGCTGCGGCAGAGGTGGGCCTATCATCGCACGCTCCGCTGTCTGCAGGCGGTGCTGTCAATGCTGTCGACGAAGAGACGGAGGAATAGTTCCA
GCGATAACACTATACTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCACGGTAGACCACGAAGCACGGTAATATACGTAAGCACAAACGGCAGATCAACCGGGACACCACAAGATAACTAGATAGTA
TGGTCTGGGCCACTATGCCATGGGAGAACGCAGCCGCGGAGCTATAGTCAGAAAATCTTCGAGCCGCGGAGATCGATACAAGTGTAGAACCTGAGCTTAC
CGAGCCACGGAGAACCGTAGTACATGGGAACACGATTTAACGGACGTCGGACCAGCCACAAAAAACACGAGGGGGGGGGGAGAGGGAGGGGGCACGTGTG
GGGTGGCCATGATTGCACACCGTGGAGCACGATGCCATTGTAGAACACGATAACACGGGCAACGCAGATGCACTACGCTAAAACAATACCATAGACAGCA
TTACCACACCGTGATTGCACGATAGCGTGATTCCGCGGTCGATGACACTTCATCAGGAGATCACGATGCACGGGCGACGGAACCACGACTGCATGGAGGC
ACCAAAGCACGGAATAGCACCCTTTGGTTAGAGCACCGGCGATGGAAGGCCAATGGTAACGAAATAGTATCTACCACGAAGCCAGTGCAACCCACGTAAA
CGTTTGAGAACGGAAAACAGTTAGCTTTAACGAAAAGGCCGTACTAAAGAGCATGAACCCACAAGAGAGAGGACAGAACCGCTGAGCAGCGTGGGCCATG
GGTGAGCAGGAACCTCGAAGCCGGGAAGAGCACGAAAGAGCATGGACCATTGAAGAAAACAACACCCAACCTGTAGTACGGGGTAACGGAAACGTTCCAA
ACCACGATATTATACGGGGCCGAATGAGACTACGGAAGGCAAGTGGTTAAATACACGATGCCAAGATCTACGGGGTGAACCACGCTCTCAAAACACGCGA
CACCAAGAAGCACTAAGGTTGCGGCCACCTCATCTCCAACAAACCATGCCACTCCGCCGCGTAGCGGCAGCGAACGGCTAGTTGTTCCTCTATTGTAGCC
CGCACATCTGTCGTGTAGTCTTGGTGTGGCTCTTGACCAGCTCCGCCAGGTCGGAATGCATATAGGAAAGTCGCAAGATGCACACCTTTCATCGCGGACC
AATGCGTCCTCTTGAATAGCTTTAGCAACAATCTGCAGTGTAGAAGTCATACGCACCACACGCGACTGACTCCGGAAGGGGTCATCACAAGTGCCGCCAG
CTTGCCGAAAAACGGGATTGCTCTTGCGTTAGCTAGTAATACATCTAAAGTCGTAGACGCCAGTTGAAGCCACACCATGGCGTAGCCGGATGATGAACCA
GGGGCACTTGCTGTCAATGGCCTCACGCCATAGGTCGTATCCGCACTCGAAGAGTATTTCAACGACAATTGTACCTACATGATGCGAACGATGAGGAACA
TGATCATGTTCGACTTTGGCGTCGACATCAGTACGTCCACAATATTTGAAAAGCTGATCGGTAAGCTGTACACGATGAACCGCTTGTCTTCGAGCACTTG
CACATTCAAAACATCCCGTGAAAACGCGGAGTCTGGTATTAAACTCCAAAGACACAATTACACTAGCAGGAATAGTTCCAGGGAATTGTTCCTCTATTGT
AGCCCGCACATCTGTCGTGTAGTCTTGGTGTGGCTCTTGACCAGCTCCGCCAGGTCGAGAGTGCATATCGGAAAAGTCGCAAGATGCACACCTTTCATCG
AGGACCAATGCGTCCTCTTGAATAGCTTTAGCAACAATCTGCAGTGTAAACGTCATACGCACCACACGCGACTGACTCCGGAAGGGGTCATCACAAGTGC
CGCCAGCTTGCCGAAAAACAGGATTGCTCTTGCGTTAGCTAGTAATACATCTATAGTCGTAGACACCAGTTGAAGACACACCATGGCGTAGCCGGATGAT
GGAAATCAGGGGCAGTTGCTGTCAATGGCCTCACGCCATAGGTCGTATCCACACTCGAAGAGTATTTCAACGACAATGGTACCTACACGCTGCGAGCGAT
GAGGAACATGATCATGTTCGACTTTGGCGTCGACATCAGTACGTCCACAATATTTGACAAGCTGATCGGTAAGCTGTACACGATGAACCGCTTGTCTTCG
AGCACTTGCCCATTCAAAACATCCCGTGAAAACGCGGAGTCTGGTATTAAACTCCAAAGACACAATTACACTAGCAGGAATAGTTCCAGGGAATTGTTCC
TCTATTGTAGCCCGCACATCTGTCGTGTAGTCTTGGTGTGGCTCTTGACCAGCTCCGCCAGGTCGGAATGCATATAGGAAAAGTCGCAAGATGCACACCT
TTCATCGCGGACCAATGCGTCCTCTTGAATAGCTTTAGCAATAATCTGCAGTGTAAACGTCATACGCACCACACGCGACTGACTCCGGAAGGGGTCATCA
CAAGTGCCGCCAGCTTGCCGAAAAACAGGATTGCTCTTGGGTTAGCTAGTAATACATCTATAGTCGTAGACACCAGTTGAAGACACAACATGGCGTAGCC
GGATGATGGAAATCAGGGGCACCTGTGTGTGACTGTGCTCACGCCACAAGGGCGTATCTCCCCCTCGAAGAGAATTTTTACAAACACATGTACCCACACC
CTGCCAACGGAGAGGGAAAATATTCATATTCTACTTTTGTGGGCGCCAATCTCAACGTCTCCCAAATTTTTGTAAGATGTATCTGATATATGTTATACAC
GAAGAGCGCTTTTGTTTTCTTAGAACAGTGCCATTTTTAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCGCGGCCTCCGTAAACAGAAAGTTATCGTCGGCAACTCCTGTGTCCTCGACTG
TTGGCGCCTCATCTCGAATAACATCTTCCAAATGCTCTCCTTTTTCGAGTATTTCGGAGACTATTCGTTGCTCAAAGACTATCTTTCGGACGATATCTAC
ATCTTTGCGACGACAGCGTTATGCGCAAAAGCAACCTGCTCTTCTACCATTCCAGTGCCGAGTCAGCTCCTGGAAACACAGTGGATCCGCTTTCCAACTT
TGTGCTGACGTTTAACACCAGCAGTAGAAGCAGGAGACGAGTATACTTTGACCAGAAGATCTGCCAACACTGGGAACTTGGCGCACCCTTGCTGCCATAT
GTTCGTAGGATGAAACAGCTTGCGCAGAAAGAGAGAAAATCATTGAGTGCTTGCCTTTGATAATCGATTGACTCTTTTGAGCTGGATTGCAGATCTGCAC
TGCGAACAGAGACCTCCCTCCCCGAGCTTAAGAAACTTGGATTCGTGTAGCTAGAAAACTTTGCCTTCCACACGTGTCCAAGTACCACGATAACCACCCA
TTCAGTTACTCGCGGCAAGCACCATCGCGCGACCATGTTGCAACGGCAAGTGCACGTCAAAAGAACCATTTGAGCCAATAAAAAAACTTAAAAAGTATTT
GATATGGTTTAATTGCCGAAATTTTAAGAAATACCAATGACAAGTTTTTTGGCCCATCCTCAACCGGACGGAACGCTGCTAATAAACCAGGTTGTAAATG
ATGTAGCTCTAGCACACGTCACAGCAATATTGATAAGATATTTATATAATTTTTTCTGTTATAATTCTGTTTTGCTGATCTTTTTTGTGTGGTCTGCCAT
GGACGCGTGTCATTCTTCAGATCGCGTCGCGCTACCATAGCCGTCCACAGCCGTCAATTTTCAGGATTGACCATCGTACCGCCGTCCGAGTACAGATCAA
AGCCTGCGCGCGAATGGTAAGCAGCCTTTGCCCCCCCCCGCTTGCACCGTGAAAACAGCATTTCCTCATATCTGTGTTGGATTCTGAATCCAGTGACGAA
GATAGCAATTCGCTCGTGCGTGAGCGCTGGACGAGTACGGAGCAATTCGCGATCAAGGACGCTAGCGTCAGTACAAAGTCGCTTACAGGAGCTCAAGCGT
TTCAGGGAGAACATCATGAGAACGAAAGAAGCGTGATGAGACGAGTACGCGAAGAGTATGCAAAGGCACAGCCAACTGCTTCATGAAAGTCTGGAGAAGC
TGTTTTCCAAAACAAAAACGCTGGAGGCGCATCACTAATGAAGGCGCAAAGATAGAGCTCTGCGGTAGACAAGACTCCTGAAGTCGGGAAGAAGGCGGAC
TTGTTGAAACGCTCTGGTAAGAAGAAGGCCGTCTCTACGGCAAAGAAACGCAAGAAATTGGATGCACGTTAGCTACATGAGATCCTGAGGGAAGCTACGA
TGGCGTTTGGTGATGACGCGGCTGACCTGGACGATAGCGGAGATGATGATTTTCCGTCTGAGGACGAATACGGCGTTCAAAGGACAGCAAAAAAAGTAAA
AACGCGTAGTTCAATAATGCGGGTGTTATTCGGTGAAGACAAGTCTCCAGTTGGAAAGAATCTACATGGCATATGTCCTCTTGGATCTACTCCAGAACCG
CTACAGAATTCGCGTGGTGGATCGAAGACTCAGAGCCTTCGTAAACAAGGTCGAGTACAACGGCGTTGCGTAGGGTACAGAAGTCTCCACCACCGATACA
GTAGAAATCGGAGGTCAACCTTCGACAGAAATTTACATCGGACGAGCTACTGAGGTATATACCGGAATGGGCTAGGCGCGCAGAACAACACTTTGAACCG
GAGGATGTACAGCGTTTGACACCGGAAACGGAGGATGTATATCTGGATCGACTCCTCGGCATGAATACAATAATTCATCGGCACTTTCTTTACTGTATTT
TCAGCTCGATGGAGATCTTGGGACATTTTTCACGAACGATTCGATTTGTTCAGTGCAAATACGTATCAACGCTTCCCCGTTTGATCGACAACTTGAGTTG
AAATACGAAACAAACAGATTTTAGGCAATAGACAATTTCGGCAAAGCCACGCAAAAAGGTTCAGCCGGGCATGAAGACGACAAGGCTACGGATCTAAACG
AAGTATCGCCGAGATATTTGATCCCTTCTTCCTGGGTGGTTTACTGCAAGACGCTGAAATATACCCATGGAATCAAACAGCGGGGACGGCCTTCGCACAC
ATCGTGTAGTGCGGTTCACTGCTTGTGTAATGGGTTACAGAAATAGGTAGATTCCTTTACATAAGTAGGTGCATACCGGTATGCACACGACTAGCGTGTG
CTGAAAATGCTGCCATGCCATTGGCTGATATATGGGGAGCCAGACCCATTATTAGCTAATTGGACTATGACGTGTATTTGAGTGGCCAGGGCTGTGGCCT
TGGCCCTCAAATAAACTCAGAGTTGATTTTTCCTTAAGCCTAAGACTCAGACTTTCTATTGCAAGCTTCGTCAATACTATAGTGTAAGCAAGTAACGAAG
TAAATACCTGGCCCGTTGCAGCTTACACTACTCGGGTCAACACAACGTTGCAGAAAATAAGGGAAGGGTAATACGATGTTTATTTGAAAGCCAAGGGAAG
CCACAGCCACGCCCTCGCTAAAGCGTTGTAGGAGTACTATGTGGAAAATCGCCGAGCTCAGGATTCTATAGTGCTACAAGCTGTGGGAGACATGCGGGAG
AGCGGATCATCAGCAAAAGGAATACTGTCGTATCTGCGACAGAATACAAATAAAAAATTTGCGATAGTATCTGTCCTGAGCACTTCGGTCTAACTAGTGT
CGCTTATCTACCTCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN