Description :
From Genome Similarity Track
Location :
Scaffold_485:7818- 11654
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_485-snap-gene-0.9Conserved gene of unknown function

Sequence
3836 bases(100 bases per row)
TGGTGGTAGAAGAAGTTAAAGTTGAGCTGCGTGAGGATCTCGGCCACGTGCGGCGACGCGCCGTGCTTCTCCATCGCCGTGAGCATGACGACGAGAAAGT
GCGATTGGCGCTTGAACTCGCTCGCGGCCTTGGTGATCTCGTCGTTAATGACTTTGTGCTCGCGGCGCAGGAGGATATGCTGGTGGTGGCCATCCTGCTG
GGCTCTCTCTGAGCTGGGGAGAGCGCTAACTGTGTCACTACTCCTCTCCTTGGGCTCTTCATCGTAGTTGAACTCGTCCAGATCGATTGGGATGTCCTTA
ATGGTGGCGCCTGGGAAATACCGTGGGATGTTGCGCTCGACCGTGTTCATGAGCTCGTCCACTTGGCTCACGAAGCGCATGATGTGGTTGAACGTCGTGA
CAATGTACTGGATGACGGTCGTGTGCTGTCAACAACATACATAGCGTATGTATGTGCTCGTGAGTCAACCAACCACGCCGCCATATAACAGAGTTAAAGA
GTCAACCTTCTCGAGGAGAAAGAACTTGTTGAGCAGTTGATCGAGGTACTTCTCGTGCGCTTCGTCCATCTACAGAAGTAGCATATCAGCAGTCAGTGAT
AAGTTTAGACAGCCAGACTGAACATCACCGTGAACTCGCTCAAGTAACTGGAAGCATACCGTGGCGATGCTCTCGGAGGTCTCGAGCACTTTTCTCACAT
CGTCCCAATTTGTGTTGGAGACCTAGATACCCAAGCAAACATTGTTGAAACAGCTGGACAAGACATTTTGCATGTTATAGAAGGGATAGAACCGCTTACC
TGGCTCGAAAGGTAGTTCATGAGGCTCTTGGTGTAGTGGAGCATGTCGTTCACCTGCACGAGCACGCCTCGGATGTCGCTCTCAATCCTAAACATCCCAT
ACAATAAAGTAGCATCTCCTCAAAATCAATCACCTCACCTCATAATAACAGGGCTGTATCAGAATTCGCCAACGTACAGGTGGAAGCAGCGCTTCTGTCG
CAGGTTGCGCTTGAACTGCCCATCCATAAGCCAGCCATACAATACTCAGCCGCAGAGCCAACAAATGAACATGCCTCCACAACTGTACGTACGTACCTTG
ATGATCGCCGACTCGACCGCCTTGACCTGCAGCAGGAAGGTCGCCAATCGGGAGTATTTCTGCATAATCGACGCACTGAAGAGCACGCGCAGCGGCTGAG
GGGTCGAGAACGTGAAGTAGATACATTTGAGCGCCGAGATGTCGATCTTCCGAGCCACGCCGAGCGACTTGAGCTGCGTCGCGTTGATGCGAACGCACAG
CCGTGCCCCCACGTGGCGCTCTCTGGACGACAGCACACGCTCGTCCTGCGTTCGCTGCATCGCCGTCTGGTAGAAATGGTTGATGCTCTCGCTGTCAGCC
CATGTGAGCGGGTTCTTCTGCATCTGCTGCAGCAGGTGGGCGCTGAGCATCGAGAAGACGTCTTGCTGCAGTATATTTACGTCCAGCACCCGACAATGTT
AGCAATGTTGATTCCATCTACATATCAACAAATGTTGATAGTGGTACCTGCTGCATGAGCACGAAGGACCGCAGCGCATCCACGTGGTCGAGGTACTGCA
GTCGCTGGCGGAAGAGACTCGCCATGGCCCCATTGAGCTTTCGACACTGTTACACACAGTCACACAACATTCATTAGTCCCAACATTGTCGGCTCAGCAA
CAATTCCGAAATTGGTGGCTTTACCTTTTGCTCCACGTGGAGCAGCAGACATTGCTTCATGGTGCGGCCGAACGGCATGTTGTGCAGGCTCAGCTGTGCG
GAATCCAACGCCTCGAAGGTGTTTCGAGTGTCCCCATACACGCCTGAGGCTGTGAGGTCGCGCAGGAACAGCTCTGACAGCGTGCGAGCGGCTGCAGCAG
TTGTCTTGGCTTGACAATCCAGCCCAATACCAGTCTCGTCAGCCCCATCTCGCTGCTGTAGGTACCGATTTTTCATCTGTCGACTCGCGATCGCCTCGTT
CAGGAACGGAATCGCTGCAGCCAGGAACATGGGCACGAGCGCAGCGTCGACTTCAAAGGGCGCGAGCGCCATCAGCGCGTCCTTAAAGCTCTGATTCCGA
GGTTGCGGAGTGTCTGCTGCAGTGTGAGGTGAGCGCTGCTTGAACGACGGGGGCGTGGCGAAGAAGAGCTCCTCGTGCAGCTCGAGCGATTCACTGTGGC
CTTTCTCAAACAGCATCGTGTGCAACAAGTCGAGATAGGGCGTCAGGCTGCTCACAAAGAGGTGCAGCAGGATCTCGTACCGGCTCCAAGCTGCAATAGT
ATTGACGTCTTGATGCTGATGGACACTGGTGATGCTGATGTTGTGGATGCCCTGGACGTATTCAATTTCCAGCTGCGCATAGAGCGCATCGATCACCGAT
TTGGCTTGCCTTGCAATGCTCACATCATGATGCTTCGTACCAGCGAACGCACCAAAACAGCCCGCGAGCATGTTCTTCAACCACGAGATGCTGCCAAAGA
GCGTCTTGAGCTCGCCGTAGATGCTCAGCAGCGTCATGCGACTGGAATCACGAGAGCCCGACAATGTTGACCAGTCAATTTCTGTCTTTGATGTGCCAGA
CAAGGCTCGCTCCTCGGTTCTGTAGATCGCCTGGTCGAAGCCTCGTAGCACCTGGGCGAGTGCCTGGGCAAGTCCTTCCAGCACACAGCAGCGCTGCTCG
TCAAACGTGTCTTTGGTGATAAACGCCACCAAGTCTCGTAGCAGCTGCAGGTCCGTCGCGGCACGTGCAAACTGGCCCAGGAAATGGCACAATGCTGTTG
GGGAAAGATGCGCAACTGCGATGCCACGCGAGGCCTTGGAGAGCTGGACTTTCGAGCCCACAAAGTCGCTGGAGAATTGAGAATTGGCATCGCTGGACGC
TGGGAGTACTTCAAATACGAGAGAGTCGACACCAACGAGCGCTTGGAACACTGCTGTAACCAGCGTTCGCTCGTGAACGATACGATGGTGCGCGAGAGAG
CCTCTGTGCTGCTGCAGCGCCGCGTAGAGCAGCCCCGGGGTCTCGAGACTCAGCAGCCCGGGCTGCTTCGCCTCTTTAGCTTTGACAGTATCATCTGCCG
CCACCAAAGGCTTGTTCTCAGACATCTCTTCGTCCGTGTCGCCATGGTGCAGCAGCGTCTCGGAATTCCGCCGCTTGCCCTTGTTGCTTGCCGTCTTCTC
TGCTGCTGGGTTCTGTGCTGCTGCCTTAGGAAAATACCGGAGCAGCAACTCGTCTCGTTGCAGAATGTCGTCATCGACTAGCACTTCGTCGTCGCTAGCT
TCATCAGCCATAGGGTCGTCGTCATCATCGCCATCTCCATGTCGCCAAGCTTCTTCAGTTGCCGTTGAGCCCCTGGCCTTGACGCCAATCTGCAGCTCTG
CCTCCAAGTTACTCGCATCGCTCACACTGTCATCACTGTCACCCTCGTATTCGCTTTCGCTGTCTTCCCACTGCTGATACCACTCGTCGTTGGTCGAGAT
CTCGAAGAGCTCCTCGGCGAGTCGTTCATGGAGCTTGTGCTCTCGTTGCTGCTCCCTCTGCGCCTCCTGCTGCTGCGCAAAGAGCTCCTCGTCTCTGTCG
ACCGCGACTGTGTCGTCACTTGCGTCCGTGGGCGACTCGGCCAGCTCGATGAGTAGCTTGAGCACCTGGTGGTGCTCATCCACACACAGCGTCGCCAGCT
CTTGCAACCGTGTGCCACGCTCACCCATCGAGTGGATCTGGAACTTTAACGCCACGTCTGCAACCTCGTCCACCACCTGCTTGCGGTGTACCTCGAGGAA
GCGGTGCGCGTACAGCTGCGCCACGACGCGGTCGAC