Description :
From Genome Similarity Track
Location :
contig_100:78177- 79305
Sequence
1128 bases(100 bases per row)
GTAAGTTTTGAGTGCTGATGGTTAAGTTGGTTCGAGGTCCTAGTTTGTGTCGTCGTGTTACTGGTGGTTGTTCAAATAAAGTAGCTATGTTGTGTAGGTC
ACTGTAGTAGTCTCCTTCCGGAGGGTTGTTGTTCGGTAGCTGATTCATGGTTATTGTTGCCCTGTCGCTTTCTGGAATAATCTCGACTCTGTTGGGAGAT
GTGAGCAGTTCTTCGATCTTGGCCCATACCCCAGCTGTATCCTGTTGGTGGATAGTTGCGTTAATATCTGCATTCTCTTGCATGACCTCAAAGAGTATGT
CGAGGTACTCAATTGTGGTCGTGGGTTGTCGGCCTCCAAAATTCCTAGTTAATCTCTGAAGTTCATTGGTGTACACATGTGCTGCTACAATAATTCTCGA
CAGATATTTCAGTCGTCCCTTACTGCAGCGTTTGAGTAATTCCATGTCTCCACATTTCATCAGTTTCAGTTTCTTCCATAGTTCAGTCGGGAATAGGTTG
AGTTGTTCTTGATTTAGCGCTGCTTGTTGCTGCAGTTCTCCAATACATAACTCCAGCCAGTTTGTGCTGGCGCTGTCTCCTGTTTCACCAGCTTTTTCCG
CCAGTTGACCCAGACAGTGAATCAGGCAGTCCAAGCGAGCCGCTGTAGTCCAAGAATCCAGTACTGCGTCTGTCATCGTTGAGAGTATGAACTCTGGAGA
TTGATACTTTCTAAGCGTTGATAGCAAAGTCCCTGGAGCATGCGTCACTACCGATTTCCATGTCTCCGTTGTTGTTGGTAGTGTAGGGAATGCTGTTGTG
GTCTCCTGTTCCCACTTCAGTGCTTCTTTGTGCCACAGTTTCCGTAGTTCTCTTTGGTGAGCCCTACTAGCACCGATGGTAGTATAGTTGGTTTCAAATC
GGCTTGGATGTGGGTTTGTTGTGCTGTCTGCCTCTGTGGCGCTCTCGTCTGGTAGAATTTCTGGGTCGTCTTGTTCCCAGACCGAGCTGCTTGAATGGGG
TCGCTGGACGAAGTAAAAGTAGGTGATGGACCTTTATCCAGTAGTTCATCTTGCCATTGTTTTAGCGTTGTTTGATCTACGTCGTACCGTTTCATCCATT
CTTGCACTGCTGCTTCATCTGACCATTG