Description :
From Genome Similarity Track
Location :
Scaffold_93:7817- 12145
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_93-fgenesh-gene-0.15Conserved gene of unknown function

Sequence
4328 bases(100 bases per row)
AAAGACCCGATTCCAAAATGCATGCCACTTCTATAAGTTAATCCTGGTACATCCACTCATTCTTTTGCTTTTGCTTCTTCGCCTTTTTCTCGGCAGCGAT
CTTCTTCCAGTCAATGTTCTTGCGCTTGAGCTTTTCCTTGAGCAGCTTGGCTTCTTCGCGGTTCTTCTCGAGATCGGTCATGTTGAAGAAATGGCTCATT
TGGCGCCCCGCCTTGTCGTTCGCGACGCCCATCGAGTGCCAGTAGTCATCACCGCCCATCTGCTCGTATTTGCCCGTGATGCGGTTGAATTTCGCCTTCG
CCGCGTAGTTTACGCCCGAGACGGTCTTCCGGTTCGCAGCATCTTGCTGAGGATCCGACACTTCCGGTGGCACCCAATCGGCCAGCTATAAAAAATTGCA
CACAACGCGAGATTAGCTCACCATATCGTCTGCTAAAGTACGAGTGCAACGAAACAAGAAAGAATCAAAAGCACGCACCCCGGACATGATCGGCGCATCG
GGCTTTTGCCATTGTGTGATGCCTGTAACCACATTGTGGTAATAAAAGCGCTGCGTGTGCGGATCCACGTGCNNNNNNNNNNTGCCACTCTGCTTTCTTG
ACACAACCTTGTGGCTGTGCACCATCGACGCCATCATCTTCTGGTACTGGAGCTGTGGCGTTTCCTGAATCAATGCCACTGAGAATCGCATTCAAGCGTC
CAAGACTGCCCGTTGGATCCAGTACTTGCTGCGTAACACGCGTCAAGCGCTCGGTGCGGACGCGAGTCAAGTGTGCTTGGTACTCGGCTGCAGCCGCGGA
CATGGGNNNNNNNNNNNNTCCATGAAATCGGTGGGTTCCTCCCACTGCGTTTTCCCACTGATCGTGTCGTGATAATACGGTTTCCCACTCGACGCATCGA
TATGCTTCACCCACTTGTGCTCGACAGTGGCCCGTGGTGCCGTCGTGTTATGCGGAGCTGGGTCGTTTGCGGCCGCCACTGGTTCACTCTCGATTGATTG
CGTCTCCACTGCGGCTGCTGGTGCTGAGGCTTGCTCAGGTTCATCTCCTTGGTCCGCTCCTTCGTTCTGTTCTGCCTCCGTTTTCGCGTCCCGTACAGGT
GGCTGCTCTTCATCGTCGTCAGATTCACTATCATGTTCATTTCCGTCTTCGTCGTCGTCTACTCACGCACAAACAGCAATACAAGCTTATCACTACGCAC
TACCCACCGCACACACACACATCGCACCATGCTCATGCGTACCTGATGCGACGTCAGCAAAGCCTTCAGGTTCCTCCCATTGCGTGACTTTATTAGCTTC
GTCGTAATAATACGGCTTGCCGGCACTATCGTCAAAGTACTTCCTCCATTTCGGCACTTTCACTGCTGCCTCCTGCTCGCCTTCGTCAGCCCCAGCGCCA
CCTTCGCTCTCAACGAAGCCTTCGGGCACCTCCCAGGACGACTCACCCGTGCTCCTGTTGTAGTAGTAGGGCGTCTGCGTGNNNNNNNNNNNNNNNNNNN
NNNGTCGTCCACGAACTTTTCCCACGCGCCGCCACCTTCCGTCATGCCCATTCACTCGATCTAATCTCAACTTTTTTTTGCTAATGCTGTCGACATGGAG
ACAGGCTTCTATTATGATAAAACGCTAAAGTTGCAGTATTAGCTTATGTTGCACGACTCGTATGCCTCTAGTTTAGAAGGTGTATCTGTCCCTCGTTTCG
TTCCTACTGTACTTTAGGCGTCCACCCAGTGTCCACCTGGTCAGGACAAGTGTCCACCTGATCAGGACAAGCGCACTTGATACACTTGCAGCGCCTGCGC
TCGGAAGCACGCGGCAGAATGCAGCAGGTAGAACTCCCACGTGCGCTTGAACGACTCGGGCAGCGATCGATCGCGGTCCAGCGGCGTCGCCTCCACGGAC
CCACCGGAGCTGAGTCGCCCCAGACGGCGGCCCTGAAGCAGCAACTGCTGCTGGTTGTCGTCATCATCGTGCCAGCGCGCTTGGAAGCGGCGGTGCCATT
CCAAGAACGTGTGCTCGTAGTGCTGCGAGTACGCCGCGATCTCGTGCACCGTGAACGCGCATTCGTCAACCAGCATACGGAACTGCGTGAGAGTGAATGG
GTAGCACGGGAACGAACTGTTGACGTACTTGTTGTTCCATCCGTGGGTCGTCGTGCGCGCAGTCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNAGCAGCATGAGCGCATTCGATTTCTGGACACGCTTGATCGTGCGCAAGAAGCGCAGTTTCTGGGAATCTACTAGAGTCTCAATGACGCCACT
GCAGACGATGCGGTCAAAATTGGACGCATGGAAGCCACTCAATGTTGTCAGAAGCTATTCACACGAGCGCACACAGAGAGGATATATGAGGAGAGTCAAT
ATAAGATGTGAAACCAATGCGTAATAAAATATACCTTGTCTGGTGTCTCGGCGAGAATAAACTCCATCTGGTCCAGAACGCCACGTTCGTCAGCAAACGC
CTTGGCGTGCACGAGTTCCTGGATCGACGACAAAACGCACACGACGGTGATACCTTCGTGTCGCTCAGCCAAGTAGCACCCAACTCCACCCCACGACCCG
ATATTTAGATCAAGAACACAATGTCCCTCCTTTGTGAGCAAACAGAAAACAAGCATCAGCGACTTCACACTCCCAATCGTTTGCTACTGTGGACTCTTGC
CTACCTCCAGTTGCAATTTCTCAGCAATGCTTGCAAGCTTTCGCGCTTGCGCTTCCTGGAAAATATTCAAAAAAATATTAAAGGAGACTGTACATGCCAA
CAATGAAAAGGTGCATTACCTCAATGCTCGTCACGCCATCGCCCCACACGCCAAAGCCCTGATGCAAGTACCTGTCCATGTAATCTCTTCGGAATTTCGG
ACACAGGTCGAATTGCTCCGATGCAGCCCCGACAACGAGTCCAACGGAGGACGGCGCATAGTTGAATAATCGAGCGGCAAGCGCCACGAAGCGTGCACTC
CACGAGCGGTACATTTCCTGTCGCGCTTCCATCGGGATCGTCATCAATCCGGCGATGACTTCGTCCAGAGTCTTCGACGCATTGACTCCCCAGAGTCCGC
NNNNNNNNNNNNNNNNNNNNNNNNACGTACGATTCGCCAATGGCAACAAGACCGTCACTCATCCAATCGAGCCAAAACGAATCGTCGCGGACGACAAAGT
CCTATTGTTTTGGTGCAGACAATGATAAAAGTTAAAAGAGTGGATTACAAATAAGATCCCAAGAAAATGAGAAAGCAACACACACACACACCACAGATGG
TTGGATGCCTCCGCTCGATAGGAGGCGACACATAATCTTCTTTGCATTGAGCCGTAGCTTTGGTAACGACAGCGACCGAACGAGTTGGAGACTGAGCAAG
ATGGCGCCAGCCACTGCTGTCACAACGTACACCCAGAACGAGCGCTACAGGACGAAAAAGACGACGGGACAGACAGAAGCATCATAAGACATTGCGGCAA
GCCATATATACGCAACAAGAAGTATTCATACATGTGCATATGTAGGGCAGATGGGCGTAGAGCAATCGCCGACTTTTGTTTCATTTTCGTCCAAGGTTAT
TCAGGGAACTGTCCAGAAAGGCCTACCTGGTGTGCCAGGACACAGAAGAGCGGGACAAACATGTTGAGCATGAGCTCCATCTTGTACGCCGCATTCCAGA
AATGCTGGGAGCGGGGTGGCGAGAAGCGGTACACGTGGTCAGCCTTCGGAAACACGCCGCCGCCGACCACAAAGTGGCTCCACAAGCGCGAGGAGCTACA
CTCAAAAGTCGATGAAAATATCACCTCAGTAACTGTGCATAATGTTGCATACAATGAAAGCCAACGGGGCACTTACATTAGCGCAGGGATGCTCATCCAT
ACGCGCACGAGTGGGAGGTAGCACGAGATGAGGAGCATCGGGAGCACGAGATGGATCAGAAAGTCTCCGATGCGTGCGAGAAACCCGAGCGTGGGGGAGC
TCGCCCAGACGCCCAGCCAGCCGTTCAACACCGCTGTGAACGCGTACCGATCAAAGATCCGCAGCGTGTACCATCCGACCATGATAGTGATGCCCATGGA
CGTCGCGATGCCACGCGCGGCGTCCGACTCGATCACGAAGTGCGTGAGCGTGGTGAAGAACAGCCAGCACGCCGTGTACATCATACGAACCCGCAGCAGC
GGCGGCACCACGACGATCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTGCGTCGCGCGCGCCCATCGAGATCGA
GCGCATCGGGCTCAGCAGCACGTCCATC