Description :
From Genome Similarity Track
Location :
Scaffold_526:7815- 8830
Sequence
1015 bases(100 bases per row)
TCATACGCAAATGTGGTGTAGGGTTTTTGCTACTTGGTATCTATACTTTTAACTTATTAGGAAGGTCGGAATACGACGTTGGAACTGACACAAGGACCCA
CGACAAGCAAGCCAATATTAGGCAAGTCAACTCATGAAGAATTTGGTTTGTCGAGTTCGGACTCGCCGAGGTCAGGCTAGTCTGATGGAGGCTCGGCGAA
TTGATGATCCTAAAGTCAAGACCCAAAGAGTTAGGACTCGTCGAGTTTAGACTCACCGAGTTCACGTGTAACGACCAGCTGGAAGCTCGACGTTCCAAGT
CACTATGTAATTGTATAGGAGAAATAGAAGAATGGATGGGATCCACACAATACGATCCTTCAAGTAGAAAATATATAACTAAATACAGAGCAAAAATTTT
CAAGCCCAAGACACGTGGACACTTTTAGTAAGTTACTGCGTGGGCTAGATTATGCCTGCCGTCGAACCTCGAGAGGCATAGATTGTATAGGTTTTGTCTG
GAAGCGCCAGGAGATAAGTCGGCCAGAGTGGTTATTACTCGCTTCCAGCAAAAGATCAGTCTCGTCACACAGCAAGCAGGTCGCTAAATTCAGGGCACCA
TTTTGATTCTCGTCGAGCGACGATTCAGGACCCTATAGACAGTTCTGGTTTTAAACTAGTCGGGCGACGAGCCAATGGACCTTTTATTGAGGACATCGTG
AACCTTGTAGTCAGGCGTATACTGCGGCCGGTGAACTGTAAACGCGTGAAAACTCCAACATCCACCCGGTTGTGTAAAGTCACAGGATTTAAAGAACGAA
AGCTGCTGAGCTCAGGCAGGCTTCTGGGAGGGAGCGTGGTTTTGGGTACTCAGCGAAGGCGGAAATCTGCAACTAAAGCCGAAGGAGTGACCCGCCCTTT
GGCGTTATCCCGGCGAATTAGCCCAACTGCGCCGACTTAATCGGCGATTGCTGTGTTGTTATGTTGAGACTGTATCACCGCAGATTTTGATTACTACGAT
ACCACACAAACAATG