Description :
From Genome Similarity Track
Location :
Scaffold_72:78148- 85119
Transcript NameFunction/comments
Phyca_LT1534555344tubulinspecific chaperone D putative
Phyca_LT1534510985phospholipase D PiTMPLD putative

Sequence
6971 bases(100 bases per row)
ctccctcgctggttcgtcttggccatgatcctcagcgtctcctgctcgttggtgtggctcgcgctgcttgttctggggccgcagctcaatctgcacgtgg
attccaccgcttatttgtacgcaggtgtgctcaattcattgctcggcagcttcctgtccgctagcggctactgctgtcagaagtacgcgcatatccgagt
ggcgcgcaattcggctctaggcaccgccacaatgcagacgacgttcctggccggtctcttcctgctggcagtcggcactgtgtcggctgtaattaacctc
gggatcctgggtcaagctgtgcaggcgccattcgcagctctcaccctcatctacagcgcgttactgggtcgattcgtgctgcacgagaccttcggcgtgt
acgacctgctctccagtgcagtgatcgtcttgggggtcggggtggacgtctacgctgctcaattggctaacattccgcacaagtcgtacacgctccagtc
gctcggacgtctgttgttgagagactcggtcttccctcttggctacactgtcatggcggtcacctacgctgtgctgctgctacggcgcgtgcatacagac
aagctacagcgccatccgatcggtcttttggcctttagctcctgtgctggagtcatggccggattcacgtcgctggcgaccaagtcggtggtggaagtaa
ccaagtcggcgctcaaagaccaggactggctcgtgttcttcaacccgttcttcatcttgatggtgctcgctatcccgtgcgcgctggttccgcagctttt
cttcctgaacaaggggctggagttcttcggtacactgaaattcatccctttgtaccaggcattcatcatcatcggcaacatgggctgcggcatgatcttt
tacaacgagatggcgagctacagctacaacgcgctcgtgttcttcctgggcggcatcgtgattacgatctccggggtctgcgtgctgttggtgaaggttg
attacgagaaaaacagtcgaggcggtcgacaatctactgctgtgaaggcggtggatcgccccatggacgagctgctggatctcaaaagcagagacaagga
aagattcgagacagatttcacgctggagcagatgaagtgggcaactgatagtgaagacgccaagccgaacgaacttcgtgtatgtcgggatttccgtgag
tgtcaagaagctattgtggagctactagtgtctgcacgtaagtccatttactactcgacgttcctgtgtgacttcactcaagttcttcacacgacgaagg
aagagcacaagggcaatacatttgcctcgctcgtgcgtgacgccgtaaatcgtggagtggatgttcatatcttgtataaccctgtgcgagactacgggac
gaattcgattgccgaccttcgtctcattctgccaccggaagtgcatttcgcttgctccgtgagtgatttgggtccgagttggtttacgcgccacttgtcg
aacaactcgagatacgcattccaccaccagaagtatctgtgcatcgatgaggaaaccatgatggttactggctgtgacgtgaacacggagcgtgagggct
ggctgaagaagaatcaccttggctactactggcacgaactcagtgttgtttgtcgatgcactccggacatggtgacgtggatccacgccaaccaccagcc
agccgagaaaaagcgctactacgatcagttcatggaatctccaccgttcccgttggtgtccggtggctggagagaggagaattgtatggtcaacatgatc
atgaatgccaagcactcggtgcaactggagagtcaaatcatgatctcgggcggttccctgcagcacaaccggatctgccctgccattgtggctcggatca
gtcaagcccaccgcaggggcgagccctttcacgcacttattctgacaaacgcagctcagaaagatgagccctcgttcctggctcgcacttactgcacgct
ctccattcagtggtcgctggagcaattggaggactgcgcgttggcctacggtctcacattggacgacttgtggcaacatctgcaggtggggcgtctcgag
aatgacggtgtattgatcaaggttcattccaatatcctcattgtggacgagaagtacgcgctgaggtcatcttcgaatctcgcagaccgcagtttgagtg
cgcgtccgaacgatacggagctgggattgctcttctccggacctcgcgtggacgagctgcagcaagatcttctcaacatgtacctgggaacggtgggcaa
gagatacacgtgggagcaagtgttcaaatgtgtcagaggttccccctatcaaaagcgaacgggggtgataaaacaactggagaagaagacgtggagtcca
gtcttcacgtggttcatgatgaatgtcttcatctacctcagtgaaggtgccactggtggtcgagttaaggtgacgtacgaaactactgtcatcagtgaaa
acaagcacgagttcgagacgtaagaaatattagaagggatttgttgttgggggtcttgccttcagaaacttgctaatagcccatttccttgatgagagtc
ttgtagctcgcttcttctggtccacttgttttcgcttcttctagcacaggcctatcagaatcaacagcctttagataaccccacagtgcagtaaacaaag
acgtttaacgtacgctttcttcgtgggcagctccatgcctaagaggtctagcagctcatttcgagccttgcgcacttgagagatctgttgaatcgtaaat
aacaggagctgttagtctgtgcctgcttcgaatgtgagtagcagacttacggaagcgtcccaggctgtatcgctcagaatctcgagtgccatatcgtact
acaccaaacccaacgcacgctcattagtacgcgcagctacagaagattaaaagaagacgacgttaaccttttcctcgtcgataacctcgtcgtgcagtag
caatcgggtgtagagcttctctgctgtcagtttccgcactttgggaaatttgtgtcccaggaaaagcactagagcacgcaacgccttcgacatcgtctct
ggatcactggggagcaaaccaatcagcacactgattgcagccgagagtttagggaccgctgtacacttttgaatctcatcacgcagagctgagtataatc
tttcaccaaagtcggtcgaagtcgtatcattgccgtcttctgtctggcgcttttcgaataaaaaccgcaggagattcgactccaagagcaaagccatcgt
cttcatgagaggaattacaacacgatcgttttgatgatggtgagtcagcaacgtcaccaagaaaaagccgaatcgagtgagcagtccgaggtctttcgcc
tgtaaatgagcgcgcatccactcgaatagagcgctcttggaagccttcaccacgctctcggtgagccctcccacactgatgacgagaccagcagcaactt
cctccataaattctggaatatccatcagttttacgactagcgggaaagtgtcatgggccattgaccagttcaccattagtgtcgaagggaagatttgtgt
ctcaagctggaatcgatcaggaatcccatctacgcgaggagtggttgaatgcagcaggcgaaacaagatactcccagctgccaatctcatgttatccagt
ttctctgcgagttgcttcgccagggccccaaactaccaccgaaaacgagttaatagatagaaagccgcaaataacaagtcatgaaaacttacaatgacgc
cgacgagatccggcgataagcgacgtacgaatggcatagtataggactcagtgaggtctatctgctgctctgcaaacttcgaacgagtttccaagtcagg
gatatggaatatccccctctcagagctactgtaaggcttgtcacctgtgctgacagacagtttgctcagatgaataagcccaactccactcggactaaag
tagtagaaccccaacgctggtttctgaaacttgacgtagcaaagaggatcagactccgactcgccgctgatttcgtcaatcttgcgttttctgtccgaca
atacgccagcaataacaccatcgccgtaggatgtctctgctctggtaccaattaagcggaagtactggcgttggccgtacgtgctttcgcccagaagcaa
tttctcgagacccaccatagcttctttacgtacccaggaaccgacatctcctcgctcatcaaggcggtaatcttcgtggatgcagcggacgagcacctgg
ataatgacatcttccatgccgtaaaggtcaagctcggctggtggtcgcgaacttaggtctactaatgcctggactgcagccacgcgactcccaggatcct
catcttcggtcggacgttcttgaagtgatagagaccgaatgacaacagtcagcacatccttaatgcagggttgaaccagttcctttgatgcaacccctac
agaacgtagaaatcctcgccgcgcagccacgttggggttcaatacttgtacagaagtcccgttctccttggctgtaactgtaattccagagttgatgtac
cttggtatcaattcctgcatgtacttgacatgaacaagactgcccttttcaaatattttgtggcaatactgagctgtgaaagcaccgaaagcatcgatag
cacaatcacgtacagtctcgttcgggtgcacaaaacattcctccaatatcgaaagatacttcttcacatgagcaaaacccaaactcaaccgagcattggc
aacagcttgaattacatcgcaaacagcagcccggatcatttccccaccgcgtccacggaacaaccgccgcttttcaacctcgacaggcagcattttcacc
ttcttctgaagctcaccgtccacaaacaccggtactagcactaaattcgtaagcaactcagtaatgctgatcacagctccatgtcgaacaatcacttcag
catctggggagagtgcagagtccagaagtcgtgggaacagctttgtcgtagcgtacgaagggtccaaagcgccaatcttccccactgctgcggcagcgag
ggtccgaatttgaacatcccaatgaacgatcttcgattcgacgagatgttccagtaatgcgtaccgatactctggatacttagcaacgaaggtgctaacg
tccaagtaggcatggcgtaaatttgccacggaaaagtagtcagctttcgtcagtaagtcaatgccattcgggaagttaagccgtccttgtcgtccaacat
tttcttgaaaagctgctgatgctgctcgtcgacagtttaactcccgatcaaacacgcagttgacaagcatagcaggcgcgagaacctgctttagccaagg
taacagcaatgagggctcataagcacgcgcgaaagaccagcacgcatagcaggcagcgtcacggacgtgggagccaatactatacgtgcctttccggata
tcatacttcaaggcgttcgccacacagtccactgcatcaggcagtcgctgtggcagtaaaactccacgtcgggcgagttctgccaacgctagactagccc
cgtgccaagctccatcgccctccgtggccacgaaaagctctagcactgactggacaatgtcgtctgcgaattcataaggcaagcgtccagtaattcgtcc
gatccccttggcagccgaccatcgaacgacagtgtctttgtctctcaacccacagagaagcacctccactatttgctccagctcttccaccacctcaaac
acgtcgtcatcgtcctcaccgctaggatcttgcgatacacttgaagtgacagtgttaccagcagtcagtcctaaggactgcatgttcagttccaacgatc
tcaagccgcgactgtagcgccacgatcgcactttaggaggcaaatacagcagtcccagacgttgcaccagcttcacactgagctttcgatgcaatgtgct
gctacttggacgatccgatcgcgcgttttcctcagtaagatgcgccactaacttcatgatggtcgcgaaatacaagcgactggcttcaatgtgctgttcg
cggggcgagttcttggcgatatgagccagacagagcataattcctgtcactttgaactgcaatatgcgtgtttcgctgccctcagacgctgcaaccaact
ctcgattggcccaggtaagaaactgcgtcagatagtgctgttccatgtccggccggcttagaagacgggacaaacacaccgctgctgccacttgagtagc
tccaggatcactcagatagtccttacagagcgccacgatgttggaaacgatggagatcgtcccattagcgtttccagccgtaggagaggaagaatcgatc
gtatgaagatcaaaaggcactaaacaaagcatcgagagccacagaagcagcacgtagcgagtctcccaggccgaatggtcagttcggtcctgagactgca
gtagatgcagcgtaggctcgaagtcgctcacttcatgtggcagtagcttcaccacagtcttgtagccgcgtactttgcacaactggtacacgacctggaa
cagtttgtggagtctcgggtctctgtagacttggcaggggaaggccacaccgtcttgagttgttgtctgcgctctatccagcatcacgcgcttgatctcc
gtcactaaagggctcagcatttcacgtagataagggtctagtagatgaggctgctctaagtatctgtccaactgctacgaattaggtgtggaattaagtg
aaattgaagaattataagacttacaatgctgatgacgctgctgtgagcggacagaaactcgcgatccacgtcgctctcgggcgttgaggtgcggtactgt
accagcttctgcagtaggtcgcgcacctgctcgcgctcctcgaagaagcgcctctcgctgcagctctcgcc