Description :
From Genome Similarity Track
Location :
Scaffold_2:78142- 86238
Transcript NameFunction/comments
Physo_127435reverse transcriptase
Physo_127436hypothetical protein

Sequence
8096 bases(100 bases per row)
CCTTGGTGTAGACACACCAAAGGCTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGCAAGCAGCATCTTTT
AGCCAATGAACACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAAATTCCCAGTTTAGAATATTACATTTCGAGGAAGTCAGAAACATAAAAC
AAAAGTAGCAGTTCTCATTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATATATACTCGGAGGTCCGAGTATAATTAACTCTAGTTTAAAC
TAAGCTACGCTTCCTCATACACGTGCGCATACGTGTGAGCCGTAGTAGTGAGCCAAGGTAGGCCCACTACACCTGGTAGCACTTTGTAGTCCGTCCAACG
ACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAACT
CACGTTGCACTCGCTGACTGTCTCCACCTGTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGTGAGTCGGCTGTAGCTACGATGC
TGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGCCGTCCGGGAC
GACACCACGCGCGCAATCGCTAAAGCTCAATGTGAGCAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCATT
GCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGAACGCCGACTCTCGG
ATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTTTGAGCCACCACAAAGCGAGTTCCGGTCGAGGGCGGAGTTCCTCGA
CCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGACGACCAAGGTC
GTCATGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGG
AGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGTCGAGGCCACAGCCACGCCCGGTAGTGAGGACAGGAGGCCCAGAACCCATGGACCTCTC
AAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCCCC
GTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTCGACTCGAGTAGGCGCGGGGCGCCCTACTGGTAATGC
GGTTCCGCGTGTTGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGGATTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACATTGTCA
TGTTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGTGTCGAAGAACTTTGTTCCACTGCGAAGTCTATCAAGGCT
TGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGACAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGCTTC
ACGTATGAAGATCAAGAGTTTGTCGAGACGTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATC
CGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCGCCGACAGGTTC
GCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCAAGCACGCGCGCAAGAGCAGCTAGCGTCGGCGTTGCCG
CCGACAGCTAATGAAGGAAATGTGTTGACCTCGGTGGTCGACACCCGCTTTTCAGCGAATCACGAAGCGTCTCCGGCCTCAAGGGGCACGGATGACGCAG
GCGGGTTACACGCCTCAGCCGTGGAGACTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAACGTGACGAAACGCCGTCGACTCCGGG
AGTCGATGGCTTGGGTGAATTTGGTTCGTCGGCTCGGGGATCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAGGCGTCGTGGTAAGGATGGC
GTGTCGACTCCGGGAGTCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACTGGAAAAACTTTCATGCTGTCGTGCACCCGGGCTGCACGACG
AAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATAAACCCGCCGGCGGTACTGACGAAGAACACCCGTCCACGGCTGGGCCTGGACG
AGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGACTCGGTCTGGGGACGAGACGCTACAAGAA
ATGTCTGCCAGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGGCGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCTGGTACAGGGAGATGACTCTCG
CTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGGCTTGCACGATGGACGCATCGAGCAAATATG
CATTCTCTCGGACGCCGAGAAAACGAAGAGCGAGAATGACGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAGAGCGAGGACACTCTCAGTGCGAAG
ACTAAGAAGGAGCGCTTTGAGGAGCAGAGCGGGGACTCGCTGAAGACGAGTCCCTTCTACGAGATTCTACGGGAGCACGCTGACGTGCTTCCGGAAGAGA
TCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATGTCGTGCCGGGGACAAAGTACTGTGTCACGCGGCAGTGGTCACTGCCGCGAGA
GCAAGTCAAGGCGATCGACGACTTTATTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAG
AAGCCACAGGGCGGTTGGCGCATCGTTCATGCATACAGCAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTCATCATCG
ATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGGGCGATGGGTTCTATCAGATCATCATGCGTGAGAGCGATATCCCTCTCACGGCAGTGAG
CACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAAAAGGTGCGTGACGCACTTGTTGCGCTCG
GTGCGCGACTTTGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGA
AGCTGCTTACGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGGGTATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAA
GAACGGTGTCCGCCCTGATCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGC
CACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGGCTGCTGAGTGT
CAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCG
ACTTCGCAATCGGACGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAAGAA
CCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCAC
GCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAAC
CCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGTGATCGAGCAC
CCCGACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACAAAGCT
CGTCAGAAACTGCCGACCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTACGGTGCAGTCGACGATTACGCGGACCGCGT
TGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGCGAGAAGACATACCTTCTT
CTCACGCGAGACTTCTACTGGACCCACCAGTATAAATGGGTGCGCAAGTACGTCCATGCTTGCGAGGTTTGTCAACGGGTGAAGCCTGCGCCTTTCGCGC
AGGCTCCCTTGCAGTCACTACCAACTCCACGGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGGACACGGG
CGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGACATG
GTGTTCAAACACCATGGTATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTC
AACTTTCGATGTCGACTGCGGATCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACGGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCATTCGTT
CCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTTTGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGA
CACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTT
GCACAGTGTCAGCCGCGACCACGCGCAAGAAGAACAAGAAGCACGCGTCTGTGCAGGGCACAGACGCCGACAAGAGCAAGAAGAAGAAGAAGAACGGCTC
TGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTATTGCTGGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATTAACTTCGTGCAG
CGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTCGGTCAACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATG
AATTCAAGAAGGGTCCATTGGTTTTGTTAGATACTCAAAACCTACCTAAACATGCAGTTCCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGG
ACCGTTCACTGTGTTGGCACGACATGGCAACGCCTACACGCTAGACATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCA
TACCTGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTGGACCAAGCGTGC
GACGCGACCGCCCACGTCGACAGAGATGGATGCCCGACGCGGTCTGCGAACCCTGAGCGACTTGAGCCCTCAGTATCACCATCTCCTGCTTCAGAGCGGC
GAACTCCCGGCTCTGATGCTGTTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCAACCACAGGTTGACCATACCCGGGGCGTGTTCCCACC
ACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAGCCGGTTCGT
TATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGGAGCCGCGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAG
GTCACCACGCACTGTCGACGAGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAATTCCCACGATCGTCGCGTTCCTCGCGTGCCAAGAACTTG
GCACGGAGATATTTGAGACTTGCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCGCGCCGCACCCGGAAGACACAACGTGCACT
GTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGCCCACAGAGGATTTGTGGAGCTGCTCCAGCCGCCCGCGCGTCGAGAATGTCTCGAAGCGTTCACG
GGCATGCTTAACCCGCTCGCGGTAAGCAGCCGGTTTCTTGTTGAAGTTCTCAACAAAAGCGTTCCAACTTTGACAAAGTGCCTGCCACTCGGGCACTTTG
CTGCGAGAAGAAGTCTTCTTGCTGGAGAAGTACCGGAGCTCGTGGAAGAGCCCCATGTAATAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCT
CCTCCGCAACAGCATCGTCGTGGATAGCGCTGCATACGTACAGCGGGATTTCGTTTGGAGGCATAGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGA
CGGCATCCACAGGTCGCGCGCTGCCTGAGCAGCGCGCGGAGAGTTTGAAGACGCCACTTCACGCGGGGAGCGTAAAGCCCCAGCAGCAGAGAGCGGAGTG
TCACTCTCGCCGCGCGAACGCTTCGAGCTCGGAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCGCTGTCGA
TAGACTCCTTGCGCTTGCTACAAGAGGCCTCGCCCTCTTCCATCTCCACGTCGCCGTCCCCGTAGTCAACAGCGTCGTTGACTACAGATGAACCTTCGAG
GACAATCTCCGGTTGAGTTGTCCCCGCCGCAGCCTTGACAGCAAGAGCGTCATGCTTTGCTTTGTGACGCTCGAGGTAGAGAGAGCCTCTATCCCGGCGG
AGCTGTTCCCCTCTGCTTCAGCGGCGGTCTTCTTCTGAGGCGAGCTCATTGCGGAATGAGACGTGAAGAATTGACGAATGGTCAATTTCCTGATTGACGT
GCCGTGACTCGGCGTGTCTAACCTTGAGGGGGGGATGGTGTAATAGGATTACACGCACAAGTGGCTACAGTCACTCGTAACTCTAACAGACACGACGTCT
GTTAGAGGCTCGAAAGACTTTCTCGTCCTTGGTGTAGACACACCAAAGGCTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATT
CCTATTGGCTGCAAGCAGCATCTTTTAGCCAATGAGCACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCCAGTTTAGAATATTACA
TTTTGAGGAAGTCAGAAACATAAAACAAAAGTAGCAGTTCTCATTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATATATACTCGGAGGTC
CGAGTATAATTAACTCTAGTTTAAACTAAGCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCAAGGTAGGCCCACTACA