Description :
From Genome Similarity Track
Location :
Scaffold_867:7814- 9604
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_867-snap-gene-0.4Transmembrane protein
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_867-abinit-gene-0.18DEAD/DEAH box RNA helicase

Sequence
1790 bases(100 bases per row)
TCACGATGATCATCTTGCTCATGAAGATCGTCTACAGAAAGCGCAAGGCGTTCCGAAGACGAGGCAAGAGAACTGCGATCGAGTGCGCGATCTTTCGGTG
TCGCGTCAAGCTGGCTCCTTGCCGAGTGCAAGTGCGTCCTGATCCGGTGGACGCCACTACCACGGCTCCTAGTGTAAGTGGTGCTCCCAGAACACGACGA
CCGAGCTTCATTCAGCAAATGCGCTTCGAGGCGTATGGCCACTCGTACGATTCGAGGAACACGGTCGTCCCAGTCAGGATAAAGTCCAAGCGCCAAGCCC
CAAGTCTTCTGCTTTTTCTCCTCTATGGCTGTGGTGTGGGCGGGATCTTGCTGTCGTTCACCACGGCTGTCACGCCGACCGATTTCGACGCGGACCTCGC
AAAGCCAGCCATGCACAGGTTTCTGCAAAATGGCTCGCTGGGGCTCATCTTGACCCTGATCTTCACCACAACCTTCACGGGCTTGTACCAACGGGATCTG
CTCTTCGCGCTCACGATGTCCTTCGACTTTTTCTTCTACGCGGCCCAGCTGATAGCGATCCACATCTCGCTCTGTGTTCTCTACCAGTGGGAGATTCACC
GCTGCTTCGGTGTAGTAACTACGTGGGCGTGGATCTTCTGGGTGCTGACGCTCGATGCGCTCACGCCAATGATGAAGACCAAGCTCAACTTCCACATCCG
ATTCGCGATCCCCGTCGTCTGTATGTTTATCTTGTGGCACGTCACGACGCTCTACAAGATCCTGGGCGACTCAGGGCCAGCAGATCGCATCATTTGGGAA
GGTAGCGTCTGGGGCCATCATCTGCAGGTCCGTGTCGTCCCGTTCTATTTCAGCCGCCTCGTGACGCTCACGCTTTGGTGCTGTCGACTCGTGAATCGTC
TCGCACAGTCGTCCAACGAAGACACCATCATCCTGCGCGGAGCGGTGACGTACGACAACTATCTTGCGCTGGACAGGCACCGCAAATCACGAGCGAGAAC
TCGGCCACGAAAGATGGGTGGTGCTGCCAACCAAATCGCACCGCTCGACCAGTCAGCCGCTTTTTCGACAATCGTTTCTGACGCTACTCCAACTCTATGA
AGAGCTTTGACGACGCAACTTAGAGCTCGAGTTTTACCTGATAAGGTTGGTCATCGCATCACACACTTTCGACAAGCACCAGGTGCATCACGAGTGCCGC
ATTTTCTTCTGCGCCTGGTCCGACCACTGGTGCCAGTTCTGCTGAGGTTGATCGAGTTCACCGCCAACTTCGTCTTGGACCCGGAACGCTCGCTTCGCCT
CATCGATGACCAGTGCGCTCGACTTGAACGCTTCTTTCTTCGCTTCATGGTGGAGACTCTGGTATATTTCCTTCGGTACCGCAGAGACTTTTGCGCCACG
TAGAGCCTGGATGAGCTCCTTGAACACCGCCTTGTCGTCTTTGTTCACCATCACAAGCGCATTCCCGCTCCCTTCATTCCCTCGACCAGTGCGACCAATC
AGGTGGATGTAGTCGGACACATGGGTCGGGAAATCAAACACCACGATGTTCTGCACCTGCAGCAGATCCATCCCGCGACTGAGCACGTTGGTGGACACAA
GCACACGGACTTCCTGGTTCACAAACGCTTCGAGCGCAAGCAAGCGGTCTTTCTGGGACTTGTCGGCGTGGATCGACGCCGAGGGGATCTGCGTCTGCTT
CGCCACAGCCTCCGCCAGCAGGTTCGCGCCGATCTTGGATTTGACAAACACGAGCTACAGATCACAAAGCAACCGTTAGTTAGCTCTAGT