Description :
From Genome Similarity Track
Location :
Scaffold_24:78137- 81360
Transcript NameFunction/comments
Phyke_g1571hypothetical protein

Sequence
3223 bases(100 bases per row)
GAGGCGGTCGAGTCAATGACTCAGCCACAAAATTTAGCTGAGCTGAGCGGATCGTGCTCCAGTGTTGGCCGAAGCCGTTCCCTTCGCGCTCTTGAGCCAG
CAAGTGCCGCCATTGTAATTCGTCCAGGTGTACGCGTGGCAATTGCCGGTTGTCTCGCAAATGGGGCAGCAACCCTCagctgtgctgctgctggcactgc
cGATATCGGTGCCCGCATAGTCTACATTTTCTTCAATGGTGGAGCACGTGATACCTTGAGATGGCTGCTGTGTAGCCCAGGCATCACCTGCACCACCAGT
CGAAATGTAGCTGGAGACCAGTTCAGCGACCTCGCGACCCATATACATGATGAATCCGTACGGGTTCACAGTGCCATCGCGCATCGCACTGGCATCCGCT
ACAAACACGTTGCTTGTGCCCAGCACACGCATCTTCTCATCGGCACAACGCTTCGACCCAGCAGATGAATCGCTGGAGGCGTAGCAGCTTCCACCGAAGT
GGTGAGCAATGAGTCCGCTGTTGGAAGCGACCCACTTAGCCACACTATCAGCGTCGGATCCAGAGGCAGAGAGGAATGTGGCGCCCTGCGCCGTCATGGC
GCCTACAACACGTGACGCGTACGTCTGTAGGGCTACCAGGTCGCGGTTTGTACCGAAGTACGGAGTTCCTTCCTTGAAAGCATACCAATTGCCGTTCTTG
TCGAAGCCTGAAGCTGCACGGGACTCTGGGTTATTTACGTAAAGCGACGTCGTAAGTGCGTCATTGCGCGCAGTATACTCACCGAAACCACGGGTGAGGA
CCGTTGTCTGGAATTCGTACATGCGACCCTGCACCTCAAAGTTCTCATATCCGATGAGCGTCGGGCCAGGACTGCTAAACGGCCCGGAGGCATTTTTGTT
CATGTATTGATCAATAGCCCATGAAGCTCTATCTCCGTAGCGGAAGGATTTCATGTCGGGGTGAGAGAAAGAAGGGAAGACGATGTTCGTGTCGAACAGA
TTCCGGCCGACGTAAGGATTCGTGATCCCATCGGCTTGCGCGACACCCGGGAACTTGTTGTTCCCCTTGAGCAGGTTCAATTGCTCGCTAGGACCAATGC
CACTTTGAATAAGTACCTTGGGGGTACTGATCGCACCTGCAGCCATGATGACGGTACCACGTGACGAAAGCAATGCCTTGGCGTTGCCACCATTGTACAC
CACGCCAGTGGCCTTACCACCTGTGCGCAGCACGTAGTCGACCTTGGCTTCAGTCATAAGTTGCACGTTGCTACGTTTGCTCATTGGGGCCCAGAACGCG
TTGGCAGGAGTGTCGCGCTTGCCATTTTTGAAAGAGTACGGGGCATGACCGAAGGTCTTGTCCTTACTGTTGCGTGCCGAGGCATCATTGATCGTGACCT
CCCTGTGACCCTGAGCTGAGAACGCCTTGGACACAATCTTGTAGCCTTCCTGCGTGTACCATTGACCATCCGTAGAAGGCTGATCTGTGTGGCTGTGaat
cttctcgttctcgtccatTTTGGACATCATGGACTCTGCGGAGAATGGCCACTGCATCTGCGTCACGTACTCGTTCGGAGGACGGAAGTATAGAGCAGCG
TTGATCGACGAGCAGCCGCCGACAAGCTTACCAAGATACATGCTCGTGCCCGAGATCCAGTCCACGCGGTACTGTGCGTAGTCACGGGTGTAGATGGTGT
TGTCATATTCGCCTGGGATGTCGAAGGCCGTGAGGCCCTGAGACTTTGCGTAGTCGGGACCTGCAGTTCCGCCCGTGGCAGCAAGAGACTTCAGACCAGC
CTCGAGAATCAGCACCGATACGCTTGGGTCTCGAGACAGGTattcagcagccacaagcCCACCCGGACCACTGCCGACAATGATGACGTCGTATGTTGAT
TGGGCGTCACAAATCACGCTGGAAGCGGCGATCGCCAGCAACGCACACGCCCACCGAACAAACATCTCTTAGTGTTCACAGCAACGAAGGAATCGCAGGG
GTACCGGTAGACGACAGACTAACGCGTTAATGGCGCGCTGTTGACTTCGGTGAcgaattgaaaagtgagtCCATTGCGCTCCTGTGAGCTGTTCTTTGCC
ATCAAGCCAGCTGGGTTAATGCCCAGTCTTGTCGCGTTTTTCGGACTGGATGCTTCTATGTGGTCTCCTCAGCGACATCGGTGATTGTCTTTGTAGTCTC
CTTAACGACACCGGTGATTGCTGCCTTGCTCATGATTTGTGGGCTGCAAGGTCGCAATGGAACGACACACTTACAGAAAACATATGCACATccgaagatg
aagagcgcacGTAATTATGTTTTAGCAATGTGATCTACTTAAGTATACACCTGCTAATACTACGCGAACGGTGCAATCGTAGTCGCGTTGCTAAAGAGAG
ATTGTCATTCTCGTAGCAATAAAGGATTCACATTTGCCCatctgaagatgaaagtaATGCAGCGAAAACCCCTATTATTACATATTTAATGATAGGGCGC
AAGGATCATCTCACTCTTAGAATTTATATATTTAGCGCTAACGAATCGTGAGTTATCATTCCAACACAAGCGTCCCCCACTCCCATTCTGTCTCCCAGCG
CCAATTACTCCACTCCCACAAGCGTTGAGAGGGCGATAGTTCCGCAATATAGGTTGCGTAgagctgttgaagttgcGATAGAGGCCGGTGAGGTACAAGC
GCAGCAATTCGTGCTTGCACTTTGGTACTGGACCATGACACAGGAGAATTCCAGTACTCgtccacgagctgctcgaaaaGTTTCCGCTCCTGATCGGTTG
TAGGACGGCGTTGCATACGTGAGTCTTGTGTTACTTGACGCGCACGGAGCAGATCAATGCCCGTACTCTCTTCGATATCTGTGGCGGATTCGAGCTGTGC
GAATAGCTGTTTTGCGCGTGTGGTCCAGGCGTCGATGAGGAGCTCTAGAAATGCATCACCGTCGATCTTTCTGTTAGAATTTAGCAACGCATTGCGCGAT
GGCGCGGCCAGTGTGAGTGCACGCTCCTGAAGCTCTTCGCACACACCAAGTGGCCATGAACAATCCACGCGGAGCTCAGTGCATGGTACGAGCCAAAAGC
GAAAGTTCCAGTAGAAATTGTCTCGAAAGAGGTCACTGATGACTTGCTGCGCTACGTTCTGTGTGAGACCGACATTATGGAAGATAACATCAGCGAGCGG
AGCTGTCGTCGATATTTCTTCGA