Description :
From Genome Similarity Track
Location :
Scaffold_792:7812- 12137
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_792-fgenesh-gene-0.2Oral cancer overexpressed protein
Pytve_DAOMBR484maker-pve_contig_792-fgenesh-gene-0.3GPI anchor protein
Pytve_DAOMBR484maker-pve_contig_792-snap-gene-0.12Deoxycytidylate deaminase

Sequence
4325 bases(100 bases per row)
TTTGAGATAGAAAACGCACCCGAATTTGAGAATCCAGGCAATTGGTGCAGGATGACCCAGTCATTCAATCTCGAACGGGTCAATTCTTGATGCGCATTTC
GTGACAAGCAATGGACATCGATGCAGCGTTCGACGAGATCTCCAACTGGGAGGAGAACCTGATAGCCGAGGGCGAGGAGCTCGGCGCCGAGCGCGGCCGC
GAGCTGGGCGTGCAGGAGGGCTACGAGCTCGGGTGTGTCGGCTGTCGTTTGGCTCGATCTGGTTGTGCCGAACAAAACACTGACAACCTCCAACCAGAGT
GGTCAAGGGAGCCGAGATTGGCGGCGAGATCGGCTTCTACCACGGCTGCTACCGCGTGTGGACGCACATGATGGAGACTGATGGGCTTAAGGAAAGGATC
AAGTGCGTAATGCTGCCGTTGCGGATATTTCGCTGGGGAAGTGAGGGGGCTAATGACTGGAGCGCTGCAATGTAGCGACCGCGCGGGCAAGGCGATCGTG
GCGTTGGGGCAACTCCTCGACGCGTTTGAACTCCGGGTGGCGATGCTGCAAAGCTGGGCGTACCGCTCGTGGTACGGAGACTGACGATGGCATGATGTTG
TCCGTGTGTGTGTGTCGCGAGATAGAACATCGTGGACGAGGACCTGATGAACAAGCTGCTGCGGATCCGCGCCAAGTTCAAGGTCATCTCGGCGCTGATG
GGGCTCCACGGCGCGCTGCAGTACAGCAAGGAGGACGTGAACGCGCACAAGAACATGTCGTTCTAGGCGGCACCGACCGTGCGACGCGATTCGCAGTCTG
GATCTCCGCGGCCGATCCATCAGCTGGCGCAACAAGATTCATCTCGATGCCGACCCCACATCCACTCGCAATGGTCGACGACGTCGATCGTTGCACAGCA
CGGCCAGGTAGCTGCAGTCCAAGCCGCTCGATCGCGAAAGACGCTTGCTGATGATGGCGAGATCGATGCGGTACAGCCAGACAAGACGGGGCGGGCTCGG
TTGAGCAACGCGTCAACGCGGCAAGAGCGCTCTTACATTAGCTCGCTAGTTCTTTGACGTTCTCGCGGCGAAAATGTTGAGCTCCCGTGCGAGATGGAGA
GGCGAGCGCGCGGCTCCAATCCATCCGGCTTTGGTGATTTCTTCCGCCTCGCTCCGGCGAGTTATTGAACGCTGTAGAGGTCCTGCGACACCCACATGCT
GCGAAATTTGATGCCGACATATCCCCTGGCCGTGTGTGATACATTCAAGCTCAACACCATTCGCCAGCGGCAGTGGGCGACTCGGCGAGAGAGCACGAGC
GCTGTAACAACAGGTGGGCGATGACGCCACTGCCCGTCCAGCTCAATTGGCCAGGCCTCGGCCGCAGCACAGCACAATCCGTCGACCCGCCAGCTCGAGC
TGGATTGTGCGGGTCGAGCGTTCGTGTTTGGACTCCCCGAGCCTGTCCACCGGGAAGGCCCCAAACAGCCAAGCCTTGTCGCCGCCACACCGGACAAGCC
AGCGCCGTCTGCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNATCCGAGTGACGGCGGACCCTGGGTTGGCCGACTGCAACTGGCTACCACCACCTCCCTA
ATCAGGGCGGTCGTCCTCGCGCTGAATCTTTCTGTTCGCGGGCAGGCCACCACCGGCTGGCCCACTCTCTGCGTCGGCCGTAGCGAGACTTCGCCCGCTT
AGTGGGCGACGGCCATGCGGTTGTGGCGAGGCCGGTCCAGCTGGCGGTCGCACAAACGGAGCAGGGCTCAAGGTGTGGGAGCCAGCCGATGATACGCTTG
CTGTTCGAGTGAGGCCATCGCCGCCCGATCGTGGCGTGCCGTTGCTTGTCCGCGCCTCCGCTTCCGGCCGAGCCGCTCGCCCTCTACGGTCCACTTCGGC
TTTCTCCCTCTACGCCGTAGAGCCTTGCAACCTCCGCTCTACCCGTCCTAGCTTCCCCTCCCTTCCTCTCCTTCAACCATGCAGGTCAAGACTGTGATCC
GCGCGGCCGCTATGGCCGCCATGGTGCTCGGCGTCGCCTCTGCGCGTACCGCCGCCAAGGACTGCGCCATGGACCCTCTGCCAACCCAGGCGGCGGCCGT
CACGACCGCCCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTCCTGCTGCTGCTGTTACGGAGGCTCCGGCCCCGGCCGCCACTGATGCCGCGGCGAC
GCCTGCTCCGGCCACGGACGTCAGCAACGGCGACAACTCGACGCCGAGCGGCGACGACGGAGACGACGACGACAGCGGAGATGATGACGGCGACGACGGC
GACGACGGCGCGTCGGCCTCGACGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGGACAGCAGACAGCGGCCGGCACG
GTCGCGAACGTGATGTCGTTCACGGGCAAGGACTGCGGCGGCGCCGGCGGCACGTACGAGAAGGTGACGGAGATTGGCTCGTGCGCCAAGACGACCGTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCGGTGTCGCCCTTCGACGACGACGTGACCGTCTCGTTCCGCGGCCCGATGA
ACATCTACAACATCGCCGTGTTCGACGGCTCGAGCGGCTCGAGCTGGGACCGCGTGTCGTGGTACGAGAACGGCGGCAACGCCGAGAACATGGTCTTCCT
CAACAACCACAACATCGACTACACGGGCGGCGGCTCGCCCGAGGGCTTCGCCACGGCCGACGGCACGGGCACCGCCACGCAGTCGACCCCGTTCTCGGGC
TCGCTCGCGGCCGCCTCCAACCCGTACGGCTCGTCCATCTACGCCGAGGACAAGACCGGCGCCGAGGTGCACATCATGACGGGCAAGCAGTGCGGCGTCG
ACGGTGTCGAGTGCACTGGCGCGTACGACAACGACGGCACGGCGTTCCAGGGCTGGACTGGCGCCAAGAAGCTGTTCATCACCAAGGTGGACATGCCCGA
GGGCGGCGCGCCGAACGTCCCGGCCATCTGGATGCTCAACGCGCAGATCACGCGCTCGGGCCAGTACCAGTGCAACTGCCGCGGCGTCGGTCCCGCGGGC
GGCTGCGGCGAGCTCGACATCGCCGAGGTGCTCGAGAAGGACACGAGCGTGGTGGCCACGCACTACTACTTCTACGACGGGTCGGTGAACCCGGGCAACG
ACCGCTTCGCGGCTCGCCCGACGGACGCCCCCACCACGTACATCACCATCATCGACGAGAGCTACGGCGTCAAGATCATCGAGATCGGCGCCGACGACTT
CGACTTCACGAGCGCGAGCATCTCGAACGAGGTCGTGCAGCAGTGGGAGCAGGCCTAAGCGGCTGCGCGCGTAGACCGTTCCTTGGTCGCAAAGGAACAG
AACGGGTGGCGTTCAGGCATGTTGTGGACTCGAGCAATATATATCTGTGCCAATGACCCACCATTGCCGCGTTGTTCGAGTTGATAGCATTGTTCATTTC
GTGGAGTAGCTGAACATGGCTTTGATGTGGTTTGCGAACCTTTGCTGAGTTTGTTGGCTCTTCATTCGACTGCCGAAAAGTCAATCAGCACGTGGGAGCG
GTGGAGTTGGTGCTGTGAGCACTTGACGCCCGCCATGTCGAGGAGGCGGCGCGATGCGACAAACTTCCAGCTACATCCACAGCACAGCATCAAGTCAGAC
AACCGTCAACGCCACCAACCTGACAGGATCACGAGCACTCACTCGTCGCGATACTTGTCGGAGCAGTAGACGACGCGCGAGATGCCGCTCTGTTGAGCAT
CACACAGAGAGCGACAATGTCAGGAGATGGTCGAGCATCACACCGACAGCAATACCAATGCTAACTCACCTGAATGATGAGCTTGGCACACTCGTTGCAG
GGGAAGAGCGCCACATAAATCTGCCACAATCACCATCATGAGAATCGCACAACGGGAGATTGCTGTCGTATTATCCTCGTCATAGAACGCACCGTGCATC
CCTTGACGTCGGTTGAGTTCTTGTTGAGGATTGCATTCATCTCAGCGTGGCAGACGTACTGTTACACATCGAGGTAATCAGCGAGAAGGTTCATACGAGC
GGGTAGCGAGGAACGCTATCACTGATCTTACCGGGTATTTGGTCTCGAGCGGAGAGTCGGAGGTGCTCGAGCGAGCCCACGGAAGCTGGTCGTCGCTGCA
GCCGTTCGGGAACCCGTTGTACCCGATGCCCACGATCTTCTTGTCCGGGTTGACAATGCTGCGAGGAATCACACCGCCACTCGGTCAATACTGCACCTAC
TTTGTTATCATAATGCACAATGCGT