Description :
From Genome Similarity Track
Location :
contig_25:781194- 785220
Transcript NameFunction/comments
g5960.t1XP_009526599.1 hypothetical protein PHYSODRAFT_504013 [Phytophthora sojae
g5961.t1XP_009526608.1 hypothetical protein PHYSODRAFT_498950 [Phytophthora sojae
g5962.t1OWZ17409.1 hypothetical protein PHMEG_0008655 [Phytophthora megakarya

Sequence
4026 bases(100 bases per row)
CTCGGTGTGCTTGTCTTTGGTGACCAGCTCCATTTCTACCTGCTTGAACGCGGCCACGTAATTGTACTTCTCATAACCCAGCCTGCATGGTGAAAAATGT
GCGAGAGCAGTTAGTCGCTTGCTCAAGAGCAAAACAGCACGACATGCAAACTTACTTTTCGAAGAGCTGCAATGAAGCACCGTTCGTCTCGATGATCTTG
CAGACAAATCGGGTGACGTGGAGCTTCGACGTTGCTGTATACGGGGAAAAATGAAGAACACAAGACCTCGTTGGTCTCATAACTCAGCCATCCACGACAC
TGCTTCATACCGTAAGCCATCATGAGCTTCACTGCCTCCTCCGCAAATCCCTTGCGGCGATACTTCTCCTCGGCGATCATGATCTCCATCTCACACGCTT
TGGGGTCGTCATAGTCGTTGAAGAACAAGTTCACGTCCCCCGCCATGCCTGCAACCACCCATTAGTCACATATCGCGTCTTCCACCATAAAATCTCCCAC
ACAGCAACCAACTCACGGTCAACGGCACTCTCGTCGACGTACGAGGCGCCTGGTTTGCCGTCACCCTCGGACTTTTCCAGTACAATGAAAGTGCACTCTG
CCAAAGGCATCAAAAGGGTAGAAACTGAGTCCACACAAAACTATCTTCGGCATTGACAGCTCGTACTCTCGGCATCTTCTCTCCACGACTTTTGCATCTC
CAACTCCTCTTCGATCGACAGTGGCTCCGACGCCGTCATCTCTGCAGCAAAACAAAATCCATGAGAGATCCACAGAAAATAGGTTCACACTACTGCAAAA
TGGTCGCAATTACCTTGCAGCCACGGGTCCTTCATCCAGTTGTGGTACTTGGCCACATGCTGCGTCTCGTACGGCACCAGCGTCACCTGCTGCCCAGTCT
GTAGACAATATAAACAACACCGAACAATACTCTTCATTAGCTTCCATTGCACAATAATATAGGTACTCGTCAATGCACTGGCCGTACAATCACAACACCC
GCGTTCGCCTTCATGTTGACAAGTCTCACACTGCGGCCAGGAGCTAACTTAATAATGGTCCAATCATATTGTTTTTTACCTTGTATTCTAGAATGTAGAT
AATGATAGATTGTAGGATTAGCTAGAAGACGTGACAACCAGATCAGAATGAGTGGCCTCGCCGCGCTCGAGGTGCCGTTCACGGAGGTTCTGCTGATGTT
ACTACGCCACCAGTGGGTCGATGTAATGTGCCTCTCTCTCCACTTTCGACTGGTAGAATTTTCGCTGCGTACTGACGTCTATGGGCGCTGCAATCTGCAG
GTGAACGATGTGGAGGCCGTTGCTGGAGTGAACAGGAGCTTGCGATCCGTCGTGGAGACTCGCAAGCTGCGACGTCTAGCGGTGCGTGCCAGCGGATTCC
CCAAAGCTTCAAGATTCAGGTACGAGGTCCTTATAAACGCAAGTGGGGGATGGTTGGTTCAAGCTCACAGGTGTCCATGACGTTGAAGCTACTGGCTGCG
AGCTGGGGACGTGTCAACGCTCATGAAGGAGATTCCAGAGGGGGCGAGCAGCCAGGATTTGTTCCTCAAGGTGGGGAGACTGTTGAGCTTTGTAGGAGGG
CGGGGGCTCATGACGTGCTGTGTGCTGTGCTGCAGCTGACGGGATGGAGAGGTTGGAGGACGAGGCATCGCTTGAGAGCACAGGCGTAGAAGGTGGGGAT
TGTGCTGGAGACAGGAGAGATAGAGGAGAGAGTAATGGGCGATTGGTGATTGCAGGAGAGATCGAGCGCGATGTAGAGCGAACTTTCCCAGCGAACCCCT
TTTTTTCGGACCAAGGTGAGAGCTGTGGTCGAGGCATCAAGCTTCTGCTGGCGTTCCTCTTGAATTGACAGTGCTGTTTCGTAGGCGACGGTAGACGGAT
GCTTAGCAATGTGCTGAAGGCGGTCGCTCATCATGCAGACGACATTGGCTACTGCCAGGTGCGTAGCTGGACGGTGACTGCAAGTAGAGCCGACCAGCTA
ACGACAAAGATGGCGCTGCGTGCGTTGCTTATCAGGGGATGAACTACGTCGTCGCTGCACTGCTGCTTGTGATAAAAGATGCAAAAGATACTGCTGACGT
GGGAATCGATGGACTCTCCCTGCAAGAAGCGGTGTTTTGGCTAACGCTGTCTTTGATTCGGCGCAAGGGGATGGCAGATTTGTGGAAGCGCAAAATGCCA
GGGTGCGTTTTATCTGGTATTTGGAGCTGAGACTACGTGAGCTAATTGCTATTTTGTATGTGGTGATGGTGCAGACTTTCCCAATGTATTTACCTATTTC
AGCAGCTGCTTAAGCTCCACTTTTACGATCTATCAGCGCACCTCCGACAAATTGGGTTGCACTCTAATATCCTAGCCACGCAGGTAAGAACACTGGGAAT
ACGGGTTTATTCGAATCTTTGACATTTCGATGTGCAGTGGTTTGTGACGCTATTTGCTCGAGTGCTTACACTTCCTACACTTGTTCGAGTGTGGGATCTC
TTCTTTATGGACGGGTGGAAAGCGGTATATCGAGTCGCGCTCGCCATTACAGCAGAATTGCGACCAAAGCTTCTCATGATGGTATGGTGACGCTGCAGCA
AACAGTCACCTACGTTTTCTGATTGCGCTCTATCGTTTTGGTTTACCGCAAAACAGGATTTGGAGCAGTGCAGCGAGTTTTTCCGCAAGAACCCAAAGTT
GGGCTTGGAAGAGGTATTTGGTCCAGGAATACTGCTGGAGAGTGCACTGGAGTACAAAGTGACGCGCTCAAGCCTGCAGCAACTGGAGGAAGAGCGACAT
CTCGAGGTAAGAAAGTCTTGGCCAGTCTTCTGTCAGGACAGATTGGTAAGCTGGTTGTGTATTTCACGCTTTGTTAGTACTTGCGTCTTCGACTACAGCA
AACTCCACTATCCGAAGAGCATCGTATGCTGTTTCCTGCCCTCGAGCGTGAAGGCGATGCTGCTGCACAGCGAAAGGCTCTGGAGCTGATCCGTTCAAAG
CTGAAGCGTTTCGACTCGGACGTCGCGAGTGACACAATTATTCTTCAGCAGAAAATCGAGGCAGCTGAGCGCGCGCAGGCCCAGGCGATGTCAGTTCGCT
ATGCCATTGCGTACGAGCTGTCCGAGGCTGCGATTGAGCTGAATGAGCGTGTCGAGGTGAAAAACCGACTGCGCTCGAAGTTCCGCAAGCTCATGTCAGT
CGCGATTGCAGCAGCTTCTTCGTCGTCGTCTTCTTCAGCAAGGTCTTCTGCGTCAGTCCTTCCGAGCTGGGTCCATCCGTTCGACTTCATCAACGAGCGA
ATGGCCAGTTGCTTTGAGCGTCTGCCTCTGATTTCCAGCTTTACCGACAGCGGGTACATCGACACCGACGACGAAGAAGACGAAGAGGTACAACGGAACT
TGGTGCATCTCAATGCGCTGGTGCCTGAGATGGCGGCAGAATTGCGTCTCCTGCAGCGCTCGGTGGCCTACAACGAGCGCTTTCTGCGTCCACTGCTACA
GCGGACGAGTCGCCTTCAGCGTGACGCGCAGCTTGCTCGTGTTGAAGTGGAGGAGACACAGCAGTTCAAAGACCGATTGGCAGACCAATTGCTGCAGATT
ATGCTGGCCAGCGAGAAGCTCAAGAACGAGCGGATGCAGCAGCTCTTTGCTGAGGTCGATCGTAGCTGATAGCACGAAGGACGCTGCGTACGTGATAAAC
GTTGGAAGTATCTACTGTATTACTACCGATGTGGAAGCAGACACGCACTAGAGTAAAAGGCGAAAGACCTCACAAGCTCTTCCTTGGTAGCAAGCGAGGG
CTTCTCCCCCTTTCAGCGTGCTTGGTTCCGTGCTGTTGTATGTCCAGAGGCGGTCACACATGAGCTAGACCCTCTTGGCTTACTCGTCCTCCGTCACGAC
GTCAGCGTCCGCGAACTCGACCGCCACGGCGGGCTCAGCGACAATGGGAGCCATGCCCGGGCCCCACGAAGGGAGATCGGCAGCAACGCCACCGAGCGAC
GGGAAGGCGTCCTTGTCGCTGGCGTT