Description :
From Genome Similarity Track
Location :
contig_25:781189- 785215
Transcript NameFunction/comments
g6239.t1hypothetical protein
g6240.t1KUF81297.1 EVI5 protein [Phytophthora nicotianae
g6241.t1OWZ17409.1 hypothetical protein PHMEG_0008655 [Phytophthora megakarya

Sequence
4026 bases(100 bases per row)
CTCGGTGTGCTTGTCTTTGGTGACCAGCTCCATTTCTACCTGCTTGAACGCGGCCACGTAATTGTACTTCTCATAACCCAGCCTGCATGGTGAAAAATGT
GCGAGAGCAGTTAGTCGCTTGCTCAAGAGCAAAACAGCACGACATGCAAACTTACTTTTCGAAGAGCTGCAATGAAGCACCGTTCGTCTCGATGATCTTG
CAGACAAATCGGGTGACGTGGAGCTTCGACGTTGCTGTATACGGGGAAAAATGAAGAACACAAGAGCTCGTTGGTCTCATAACTCAGCCATCCACGACAC
TGCTTCATACCGTAAGCCATCATGAGCTTCACTGCCTCCTCCGCAAATCCCTTGCGGCGATACTTCTCCTCGGCGATCATGATCTCCATCTCACACGCTT
TGGGGTCGTCATAGTCGTTGAAGAACAAGTTCACGTCCCCCGCCATGCCTGCAACCACCCATTAGTCACATATCGCGTCTTCCACCATAAAATCTCCCAC
ACAGCAACCAACTCACGGTCAACGGCACTCTCGTCGACGTACGAGGCGCCTGGTTTGCCGTCACCCTCGGACTTTTCCAGTACAATGAAAGTGCACTCTG
CCAAAGGCATCAAAAGGGTAGAAACTAAGTCCACACAAAACTATCTTCGGCATTGACAGCTCGTACTCTCGGCATCTTCTCTCCACGACTTTTGCATCTC
CAACTCCTCTTCGATCGACAGTGGCTCCGACGCCGTCATCTCTGCAGCAAAACAAAATCCATGAGAGATCCACAAAAAATAGGTTCACACTACTGCAAAA
TGGTCGCAATTACCTTGCAGCCACGGGTCCTTCATCCAGTTGTGGTACTTGGCCACATGCTGCGTCTCGTACGGCACCAGCGTCACCTGCTGCCCAGTCT
GTAGACAATATAAACAACACCGAACAATACTCTTCATTAGCTTCCATTGCACAATAATATAGGTACTCGTCAATGCACTGGCCGTACAATCACAACACCC
GCGTTCGCCTTCATGTTGACAAGTCTCACACTGCGGCCAGGAGCTAACTTAATAATGGTCCAATCATATTGTTTTTTACCTTGTATTCTAGAATATAGAT
AATGATAGATTGTAGGATTAGCTAGAAGACGTGACAACCAGATCAGAATGAGTGGCCTCGCCGCGCTCGAGGTGCCGTTCACGGAGGTTCTGCTGATGTT
ACTACGCCACGAGTGGGTCGATGTAATGTGCCTCTCTCTCCACTTTCGACTGGTAGAATTTTCGCTGCGTACTGACGTCTATGGGCGCTGCAATCTGCAG
GTGAACGATGTGGAGGCCGTTGCTGGAGTGAACAGGAGCTTGCGATCCGTCGTGGAGACTCGCAAGCTGCGACGTCTAGCGGTGCGTGCCAGCGGATTCC
CCAAAGCTTCAAGATTCAGGTACGAGGTCCTTATAAACGCAAGTGGGGGATGGTTGGTTCAAGCTCACAGGTGTCCATGACGTTGAAGCTACTGGCTGCG
AGCTGGGGACGTGTCAACGCTCATGAAGGAGATTCCAGAGGGGGCGAGCAGCCAGGATTTGTTCCTCAAGGTGAGGAGACTGTTGAGCTTTGTAGGAGGG
CGGGGGCTCATGACGTGCTGTGTGCTGTGCTGCAGCTGACGGGATGGAGAGGTTGGAGGACGAGGCATCGCTTGAGAGCACAGGCGTAGAAGGTGGGGAT
TGTGCTGGAGACAGGAGAGATAGAGGAGAGAGTAATGGGCGATTGGTGATTGCAGGAGAGATCGAGCGCGATGTAGAGCGAACTTTCCCAGCGAACCCCT
TTTTTTCGGACCAAGGTGAGAGCTGTGGTCGAGGCATCAAGCTTCTGCTGGCGTTCCTCTTGAATTGACAGTGCTGTTTCGTAGGCGACGGTAGACGGAT
GCTTAGCAATGTGCTGAAGGCGGTCGCTCATCATGCAGACGACGTTGGCTACTGCCAGGTGCGAAGCTGGACGGTGACTGCAAGTAGAGCCGACCAGCTA
ACGACAAAGATGGCGCTGTGTGCGTTGCTTATCAGGGGATGAACTACGTCGTCGCTGCACTGCTGCTTGTGATAAAAGATGCAAAAGATACTGCTGACGT
GGGAATCGATGGACTCTCCCTGCAAGAAGCGGTGTTTTGGCTAACGCTGTCTTTGATTCGGCGCAAGGGGATGGCAGATTTGTGGAAGCGCAAAATGCCA
GGGTGCGTTTTATCTGGTATTTGGAGCTGAGACTACGTGAGCTAATTGCTATTTTGTATGTGGTGATGGTGCAGACTTTCCCAATGTATTTACCTATTTC
AGCAGCTGCTTAAGCTTCACTTTTACGATCTATCAGCGCACCTCCGACAAATTGGGTTGCACTCTAATATCCTAGCCACGCAGGTAAGAACACTGGGAAT
GCGGGTTTATTCGAATCTTTGACATTTCGATGTGCAGTGGTTTGTGACGCTATTTGCTCGAGTGCTTACACTTCCTACACTTGTTCGAGTGTGGGATCTC
TTCTTTATGGACGGGTGGAAAGCGGTATATCGAGTCGCGCTCGCCATTACAGCAGAATTGCGACCAAAGCTTCTCATGATGGTATGGTGACGCTGCAGCA
AACAGTCACCTACGTTTTCTGATTGCGCTCTATCGTTTTGGTTTACCGCAAAACAGGATTTGGAGCAGTGCAGCGAGTTTTTCCGCAAGAACCCAAAGTT
GGGCTTGGAAGAGGTATTTGGTCCAGGAATACTGCTGGAGCGTGCACTGGAGTACAAAGTGACGCGCTCAAGCCTGCAGCAACTGGAGGAAGAGCGACAT
CTCGAGGTAAGAAAGTCTTGGCCAGTCTTCTGTCAGGACAGATTGGTAAGCTGGTTGTGTATTTCACGCTTTGTTAGTACTTGCGTCTTCGACTACAGCA
AACTCCACTATCCGAAGAGCATCGTATGCTGTTTCCTGCCCTCGAGCGTGAAGGCGATGCTGCTGCACAGCGAAAGGCTCTGGAGCTGATCCGTTCAAAG
CTGAAGCGTTTCGACTCGGACGTCGCGAGTGACACAATTATTCTTCAGCAGAAAATCGAGGCAGCTGAGCGCGCGCAGGCCCAGGCGATGTCAGTTCGCT
ATGCCATTGCGTACGAGCTGTCCGAGGCTGCGATTGAGCTGAATGAGCGTGTCGAGGTGAAAAACCGACTGCGCTCGAAGTTCCGCAAGCTCATGTCAGT
CGCGATTGCAGCAGCTTCTTCGTCGTCGTCTTCTTCAGCAAGGTCTTCTGCGTCAGTCCTTCCGAGCTGGGTCCATCCGTTCGACTTCATCAACGAGCGA
ATGGCCAGTTGCTTTGAGCGTCTGCCTCTGATTTCCAGCTTTACCGACAGCGGGTACATCGACACCGACGACGAAGAAGACGAAGAGGTACAACGGAACT
TGGTGCATCTCAATGCGCTGGTGCCTGAGATGGCGGCAGAATTGCGTCTCCTGCAGCGCTCGGTGGCCTACAACGAGCGCTTTCTGCGTCCACTGCTACA
GCGGACGAGTCGCCTTCAGCGTGACGCGCAGCTGGCTCGTGTTGAAGTGGAGGAGACACAGCAGTTCAAAGACCGATTGGCAGACCAATTGCTGCAGATT
ATGCTGGCCAGCGAGAAGCTCAAGAACGAGCGGATGCAGCAGCTCTTTGCTGAGGTCGATCGTAGCTGATAGCACGAAGGACGCTGCGTACGTGATAAAC
GTTGGAAGTATCTACTGTATTACTACCGATGTGGAAGCAGACACGCACTAGAGTAAAAGGCGAAAGACCTCACAAGCTCTTCCTTGGTAGCAAGCGAGGG
CTTCTCCCCCTTTCAGCGTGCTTGGTTCCGTGCTGTTGTATGTCCAGAGGCGGTCACACATGAGCTAGACCCTCTTGGCTTACTCGTCCTCCGTCACGAC
GTCAGCGTCCGCGAACTCGGCCGCCACGGCGGGCTCAGCGACAATGGGAGCCATGCCCGGGCCCCACGAAGGGAGATCGGCAGCAACGCCACCGAGCGAC
GGGAAGGCGTCCTTGTCGCTGGCGTT