Description :
From Genome Similarity Track
Location :
contig_4:781076- 782224
Transcript NameFunction/comments
g1220.t1polyprotein, partial

Sequence
1148 bases(100 bases per row)
CCAGTAGGTCGCCCCGCACCTACTGGCCCCGGCCGTTTTTTGGCTGTGCGGCCGGAATCCTCTCGTCGGGCGTGACGTGCTTCATGTGGGCGAGGATCGG
AGCTGGCGCGCGGCACACCGCCGCGCGATGACCAGGCTTTCCGCAGCGGAAACAATTCAGCGAGAGGTCATTCTGACCACCGCGGCCTCTCCCAGAAGAC
GACCACCGTCGGTTCTGCGAAGCCTCGATCGCATCGATCTCCATTGGCTCGGGTACCGACACCCGAGTGCGCAGGCATCGTCTTGGCGTATGACGACGTC
ACCAGGTAGTCCTCGCGTAGCGCGAGAGCGAAGGCTTCTTCCAACGTGGCAGGCTCGGCGCGCGTGAGACAGTACCGCGTCATACCTTCACACATACCAA
ACACAAAGACATGGACTTGGGAAGCCATGTCGATCGGCTTCGTGACGATACACGATGCAAGGTGTCGCGTTCTCTGGACGTAGTCGCGCATGGCCATCTT
GCCTTGCTTTAGGGCGAAGAATGTAGCTCGAACGCGCGACTCATCTTGCGGTGGTTCGAAGGCGAGACGCAGGTCGCTCTGGAGTGCCTCCAGAGTCGGG
AACGCGTACTGGTCGACGACAAGTTTGCCGAGAGCCCATTCTTTGGCCTTTCCGGATAAACGGGATAGCAGGAAGTTCACCTTGGCTGATGGCGCCTCGA
TTAGCCTCGAGGCGATCGCGATGTCGATCTCTCTGAACCAGCGATTCAGAGGTAGGCGATCAGGACCCTCGCCAGAATAGGAGGATGTCTCCATCTTGAC
GGCATTGTTCCTGGACGCATGCGAGGGAGTTGATACTCGCCGTTTTGCTTCGGCGAGCTCGCGGTCCATGAACTCTTGGATGGCTTGGCGCTGTTGGTCG
GGGGTCGCTGAGCTCAGCAGCGACGTGACGACGGTTTCTCCGGACACCGCCGCGAGGCGGTGCAACGCTTGCCACTCGATAGACGTGAGATGGGGGAAGG
CCGCGTGTTCCAGGGTCATCACTGGAGGTCCGGCGGGCTGGTCTTCACTCATCTCGAACTTGGTCATGGGAAGGACTACAAGTGCTACCAGGTGTAACGG
GCCAGGTGAGTGCCCGTCACTAGCTTACACGTAGCGGTGAGGAAGCGT