Description :
From Genome Similarity Track
Location :
Scaffold_2606:781- 2364
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2606-snap-gene-0.3Ribonuclease H2 subunit B
Pytiw_DAOMBR242034maker-piw_contig_2606-fgenesh-gene-0.1Intraflagellar transport protein 25

Sequence
1583 bases(100 bases per row)
AGACGGGAGCATGCTCGTGTTGACTCCGATTGATCCGCTGTTTGTGCTCCTGGCGAGCATGTGGCGCCATCGCGAGCGCTCCATGGCGCTCTATGATCTG
CTGTCACAAGACCACAACTCGTGGCTGACGCAGATCGCGACCTGCACACCCGAGAAGATCCAATTGGTCTGCGACGTGCAGCCCAATGGCGGAAACGACA
GCCTCGAGAACCTCTTTGTCAAGGCGAACGAGGCCAAGGCTCTCAAGTGGCTCTCTGCAAAGGTGATCATGTGGACAGCAGTATAACTGATCTTGTTATG
TATACTTACGAGGCGTTGTTGTGTGTGTTCGGCAGGTGAATCGCGTCGCAAAGACGCTCGCGAAGCAGGCCAGCAAAGCTAAAGCCCAGAGCAACATGGG
GAATTTTAACGCGAACTTTGTACTTCCAGGCCAAAGCGCTGAGTCTAAGGCAGAAGTTGACAGCTTAGCCAGTGTGGTACCGCTCGACCCGTCAAGTTTC
AATCGCGAGGCCATCGAACTCCTCGCTGACTACCTGCCGGACGAGCTCACCGAGTTGCTCTCCAAGGAGTTCAAGTACGTGCATAACATCACTCTCATGA
TGGGAACCCACGCACAAATGACTCAATACACTAACTGATTTGAAATTATTGTAGGCTTGAGAAGCTGGCTCCAGTGGTGAAGCAAATGGCCACTCCCACG
AACCCACACGAGACGTTCCAGCGCTTCGACCGGCGCCAGGTGGAGACCACGACCAGCAACAAGCGGACGCCATCCCCTGCTGCGGCCGCCGCGGCTGCCA
AGAAGAAGAGCAAGCTGGCGAGCGTCGACCGGACAGGTATGAAGTCGCTCACGTCGTTTTTCACCAAGAAATGATCTGCATAGAGAGAGCTGCAGGCTGG
AGAATGGGAGCATGCAATCATGGAAAATGCTATTATATAGAGCTGATGTTTATGAAAAAGGTTGGCGTGTTGGAAATGGATTTATCGCCTGGACGTCGAG
CCCTCGACGCTGACGCGGTGTAGCATGACAAAGTCGCTCCAGCCCGAGAGGATCTTGAATTTTACGAAGGACGCGTCGCCGAGCTTCACGTTCTCGCTCT
CGACCTGCATGTTACCGTCGTTCTCGCCCAGCTCTACGACATTTTCACAAGGTTAGCGAAAATGGTTGGCCGACAATTTCCGAAAATCACAATTTCCACA
GTCCATCATAGAAAAAGTCAACGAACGCACTCGAGTCGTAGAGCTTTTCCCACTTGGTGGGCGTGGGGCCGCTGCAGATCTCGACGCTGACCTCCTTGAC
GTTCGTGCTCCACGTCTTGACGCGCGAGATGGAGGCCGTCGTGGCCAGCTGCACGACCACCTCCTGCGGGAAGCTGCCTGTCGTCACCCACTTGGTCGTC
TGCTCTCTGTGAGTTAGCATCACCAATCGGGATCAGCTCTAGGCAGACCACCAAGTCTAGATAGACGCAAGAGATAGCAACGTACCCGTCGAGGATGTTG
CCAGGCGGGAAGTTGGGGTCGAATGACGTCGCGGCGGTCACCTGCGCGCCCTCTTCCTCCAGCGTCAGGTCCATTTCGGCTAC