Description :
From Genome Similarity Track
Location :
Scaffold_138:78093- 81363
Sequence
3270 bases(100 bases per row)
CCCTTTACACCTGGTAGCACTTCGTAGTCCGTCCAAGGACCACAAAACCCGTTTAACATGAACATGTTGGACGACGAAGGCGACGAAACCTTTCACGGCA
CCCGTGAAAGTTACTCCTATTTGAGCGATGTCGAATGGAGTGCGGTCGAACGAGTTCGACTGTTGGCGAAGAGGCTGTCTGGTTTCTGCTATCCTCAATG
GATAGGGACCAACAGCATTCCATAATCGCCAAGTTCTTGCAGCGAGAACTTGACGCGTCGCGAGCTGAAGTGACCCTGCTGCATCAGCACGGTCACCAGC
AGACTGAGCGCCTGAGTCAGCAACAATTTCAGTCTGCTACTGCAGCGTCGACACGTGAGCGTCGACGCGAGACTCTAAAGTTAGAAGTCTCCAAGTACCG
GGGAGTCGAGGAAGACCTTCTGTTGATATGGTACCTCGAAGTGGGCGATACCATTAAGGCTCGCCACATCGACGATAAGGAAATGAAAGTTGCATTTGCC
GAATCTAATTTGTCAGGGCGTGCCAGAACTTGGGCCCTGAATCTTCAATTACACGATCCAAACGTGTTTGGATCGTTAACGGTCTTTAAGACTCTGCTCA
GCCAAACATTTGAGCCGCCAAGAGCTGAGTTCAGGACTCTTTCAGAGCTCCTGACGATAAAACAAGGTAAGCGTGACGTTTACGCTTACGCTCAGCACGT
TCGTTACCTTGCAAGTTGCATGGTAGCGAATCCTGTAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTCATAGATGGTCCCGTGAGGAACCAT
CTATTCCGCATCGAGTTAAAGTCGCTTGAGGAAGCGATCACAACTGCGGTTCAAGAGGACTTTAGTGTAAGACAGGCTCACATTAGCTTGACCCCCTATC
GTCCTTCGAGACGAGTAGAGGCGGGAGGTCCAGAACCAATGGACCTCTGCAGAACTGAGAGCAAGATCTCGCTCTTCAAGCAGTAAGTGATTGCAAAAGT
GCAATCGCTGTCAGAAATTAGGACACTACGCATACGAGTGTAGTACTTCACGCCCAGTGTCTCGTAACACTGAGCGAAGTGATCGACCGCCTGCCAAGAA
GGGCAACGGACGCGGGTCCGACGCTGTTGCGAAGTCACAACAGCGTAGAGGACCGTCAAAAAACGGTCGGGGTCAGCAGGGACGGAGCTCCCTACTGATC
CAGCAATCTCAATAGAATTTGCAAAAATTACAAATCTATTGATGAAAGTTGCTCCAGACTCACAATCCTTGTGTGTCTCTGCACTTGGTGAGGTACCCCT
CATCACCTTGAATTTAGAATTGACAAAAGATTTTTCACTTCGTGCCTTAGTTGACTGTGGGGCGTAGAACAACTTTGTTCGTTGCCAGTCGCTAGAGGAC
CGTAGGCTCAAGTCCGTTAAGCGCGTTACTCCTCCTACGAGGTTGACGGTGCGCCTCGCAACAGGCGTATCGATAGCGATGATGAAACGTGTAGTATTAT
TTCACTACATGTTAGAAGATTTGCAGTACAATGATGATTTCATCGTACTTGATTTGGATGAAAAATTTGATGTCATCCTAGGGTTACCCTGGCTCAGAAG
GTACGAGTCAAGGGTCAGCTGGCAGCATCGAACCGTGAAGATCCCTGCCACTTGTTCATCAAATGGCCATCTGATGAACGTCTTGGAGCGTCCACAAGCG
TGTGGATGTACTGCGAGTGAGTTCGATTGCCTCACTTGCGGTACGGTCGTTAGTACAACTGCACAAGATCACATTGTGACAACCAATCGCACTGTTGAGG
AAGCTGCCGGCGGCTGTGCGGATACATAGGCAGCGCCGAAGATCCACCACTCGAACAAGTCGAGTGCATCGGGACATAGGTGTGCGCCTAGCGGGAGACA
TCCAAGTAAGAATAAACCAGTTGCCCACACAGGGCAACACGATGATCCTAGACCGACTGGAGAGTCAATCGTAGAGGACATAGCTGTGGTAGCGCAACCA
CAGCTAGAAGACGTCGAGGGAATAGGCCCCACGTACTTGAGGAAAAGGGTTCCAGGAAGAAACCGAGACATTGAATGTTTTGGTTAATGACGGGTCAATT
GTAGGCGCTTATACACTTGATCTGATCGCGCCTTCGAAGTTGACTTCGGAGATTACTCAATTGCCAACGCTAGAACGGAAACGATTCTTGCGAGATCTGC
GTAGTGGCAAGATCAAGCAGATCTGTGTACTCGTCACGGAGGACGAGTACGTGACCGACATTCGGTAGGCAGTAATATTTGCAGAGAACGAACGGGTTAT
CAGCAGCTCATCAATGGACGAAAGTGTCCTCGATGAGAAGACTTGGGTTGAGAGATACACGTCTCAATCTTGGGAGTCGTTTCAGGCAAATCCTTTATAT
AAGGATTTGATCGATTTCAAGGACGCATTCTCTGAATCCGTACCATGCCAATTGCCTAAGGATAAAGGCACTCGACATGAAATCGAGCTCAAACCGGGCT
CGAAGTACTGTGTCATGCAGCAGTGGCCACTGACTCGTGAGCAAGTACTTGCGATCGACAAGTTCTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGGA
GTCAACTTCCCCTCACAGCTCTCCGACCTTCTGTGTGCGCAAGGCCACCGGAGGATGGCGGATAGTGCACGCATTCAACAAGTTGGATGCTGCAATGGTA
CCGACTCAGACGCCGATACCGAAGAAAGACGTAATCATTGATAGTATGTCAAAGAGTACCATCTTTTCGTCCATCAATCTGATGGACGGCTTCTATCAGA
TCCTAATACGTGAACGGGACATCCCGTACACGACAGTGAGCACCCCGAGCGGTATGCTCTGGGAGTGGCTAGTAATGCCACAAGAGCTTAGAAACGCCCC
TGCCACCTTCGACAGATGTGTTACAGATGTGTTGAGACCGGTGCCGAGACTTCGCACCGAGTAACTTCGATGATGTATTCGTCCATAGCCGGGCTATGGG
CGGAAAGACGGACGTAGAGGTTCATAGAACACACGTTCATCAGGTTCTTACACTTGTGCGCAAGCATAAGCTGTGCGCCAACCTCAAAAAGTGTATATTC
GCTGCTAGCGAAATACCATTTCTTGGTTGCATCGTGGGTAAACAAGGCGTACGCCCTGATCCTGAAAAGATCAAGGCGATTACCGACTGGCCTGTGCCAG
TCGACGTTAAGGAACTAAGAAAGTTCCTTGGTCTAGCGGCGTACTTACACAAGTACTCACGCAACTACGC