Description :
From Genome Similarity Track
Location :
Scaffold_7:78093- 79663
Transcript NameFunction/comments
Albla_Nc14010530villinlike protein putative

Sequence
1570 bases(100 bases per row)
GAAAGAGCAAGTTTTCTGGCGGAGTGGCTTCACTTTCCAACACATCTCGGACTTTTCCTCCCTTCCTGACGATCATTCGACCTTTAAATAATCGACGGAA
ATCACTCGGCTCTTTTCCTTGGACCACGCGGACCAAAGCTGATGCATTACTCACTTCCTCTCCGAGCTGAACTGCGATCATTGCAGACGCCGTTTTTTCA
TCAGTGGAAGACTGACGGCCTTGCCAAAAGTAAATCAAGCTCTTGCGTGATTGCGAGCCGTGTGTCAACGTCAGCATTCTCGAGCACATAATCACGTAGC
TGTCACCTCCATAGAAAACACCATGAAATTCACTTGGGACTTCCACTTTCTCCAGATTCTCTATACGCCAGATTTTCAACTCGACATCAGTATCGATGCT
AGATTCGCCTTCGTTCTGCTCTTCAGGTCGAAGTGCGTGTCCTCCATTGACCAGCCCAACGACGTCGACATCATGCCCACTTGAATTCTTTGACAAAGTT
GCAGGCTTTTGTTGAACAGACTCGGAAAAGGGCGAGGATTCCCAACTTTTGAATAAGCTTTTGAAGAGAACCGATTCCGCTTCTTCCACTACTCGGGTAA
TTGGAATCTGACTTGCATGTTTCTTCTCTTCACCGAGGAAATGCATTGCATTCACCATAGACTTCTTTCTTGCATCGGTAGAGACGCCATGACCTACCCA
TACATACAGAATTGAAGCAGTATCCACCAAGTACATATTGTCTGTCTGCAACAAATCCTTAGTCAAGATGCCGGTCTGAGACGTCTCGTCAATGAATTTG
ACGTCATCTTCTGAGCTGATCAACACACGGTACACTCTCGTACTGCTCTTGGCAGCCTCACTGAAGTCTTCATCCGACTGTGCTGGAACCGTATCACTTA
CGTCAATATAGCCTCCGAGCAAACTCCAGAACTTCTCATTTTTTGGTTCATCATCGAGCAAGGTGATTTGACTCTTTCCTCCCCTTTCTTCACTCCGAAG
CTTGAGCATAAAGTCTAAACCTTTAGCTTTTTCAATAATACTTGCTTCTCGTCCGTTGTATAGGAACAACTCGTCATATGCATCAAGTACGTAAACATCA
TTGCAGTTCACAGATGAATTCTTCACAGCAACAATAGAGATCCGAGCCACGTGCTTGCCCTTGATCTGAAACAGCTTGGGAGGTTTTTCAGCATCTTCTA
CTCCGGTGACAGAAGTCAACCCACTCGATACTCCACCAGATAAATACACTAGCGAGCCCAACTCTTTAAAGTAGGATAGAAAGAGAGGCTACAATTGAAG
ATAAATGAGTAATCAAATCATCGAGAAAGGATTCAAGTGTACTGATTCTCTTCCTTGACACTCGCGATACTCTACGGGTGAGCCGTCCAACGCGTCATCC
AACTCAACGCTTTTATACGCTGCAACAAACTGCTCATCGGTGGTTGTCTCATTTCCGAGCCAAAAGTGTATATTCCAAGAGAATCCACTACATGTTTTCA
GCTTAATATACAGTTTATCTAGCTTGCTGTCAACTCTACCTTTCATGCTGAATTGTTTTTAGGAAAATGT