Description :
From Genome Similarity Track
Location :
Scaffold_416:7809- 11775
Sequence
3966 bases(100 bases per row)
GCTAAAAACTAATTGTGTAGGCGTCAAAGAATATTTCTAGCGATCGGCAGGCAACAGCTCTAACAGCGTCACGTGCGAGCGCGGAAAGAGCGGCAGCGAC
TGCTGCAGCACCTGCAGCAAGCTTCCTTTGCCCGTGCTCGCCAGGCAGAATTGCACGGTCCGATGCCTTCAACCCATACTGCATGCTCGCAATCGAAATG
GCAAATTCAGGAATGAATCGCTGAATTGGGTGGGGTTTTTGTTGTAGTAGAAAGATGTTGATCCTAGAACTTCAACACCGTTGGATCGACCATTTAAGTA
CACAATATTGAGAGTGGCGAATGAGGCTTGTAGTCGATGTGAGCAGACGGAAGGAAATCCGAAAGTGAGTTTATTTGAGTTAGTTGTCTTTGTCCTGCTT
GTTCCTTCCTACTCTTGTAGCTCTCCTAGCATCTCCCTCGTTTGACTTCATTTAACTATATGCATGTGCAGCGGTCACACTTGAGTGGGACAGGCACGGG
CCGTCAGCCAATCACAATGTCCCGGGACGGGCACACTCGATTGGGACGGACACGGTCCATACTCAAACACAGTTGGGACGGTCACACCTGATTGGGACGG
GCACGGTCTGTCTCGTCAATGCATGTGATTATCCATGCTAATCACAGCTGTTGATCCGACTTCAACTGTCTCGCCCAATCATATCAACGCAACCCAGATG
ATCCGCCAATCAGGTCACAGCATTCGCTTCACTACAACTTCAGCCCCCTAGAGGCACGCGCCACGCACGCGCAGGCCGTGAGGCTCGTAGCAGGGACCCA
GTCGAGTAGACAGCGAAGTGCAACCACAACACACAAAGCCGTGCTTTGCACGGAGAAGCTCTGGATTTTCGAGTCTTTTTTCCATTTTTTATTTACATGT
ATTGTGCTTTGCAGACTTTTGGTACTTCGGACTGTAACTTGTACGACTTATCGAGCACGACTTATTGATAAATCGTACTCGAGTTCGAATTCCTGAANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGTCAACTGAAACCTCTCACACTGCCTTGTTCAATACGAGGTTTTCGATGAACGTCGGTAC
GCTGCGAAAAACGCTAACGGGAAAGTTATGCTAGTTCCCGCTCAACCGGTAACTGCGTTTACGTCCCCATCCCTAATGTATTACACTCTTCACCCGCATA
CTGTACACTCTCCAGGACATCGTCATATCGCGAGCATAAGGAATCACGGGGGTGCCGAAGGCGTCTCTAATCCTCGATTACTTCTTGCAACACACAGGAA
GAAGTAAAAAGATTTGCTGTCGTCCATGAGGGGGATCGCCTTAGCGATGAGGCCCTCCATTTGGGTAAACAGATGACAGTACGCCCCAAATAGGTCAACA
CGCGAACCCAAAAGGGCTGAAGCAAACCAAACCAAATTGTTTGGTTCGAACGTATCATAAAAATACCGATTTCGAACCTGAAACTCTTGGTATACTGGTT
CGTTGTAACCGATTAAACCATCGTGGCGGGCTTGAGTGTTCGGTTTGGGACACGAAAGATTCATAATCCCCTGCATTTTATTGGTTAAAACTCCGAATAG
TCACCCCTCGCTTTATACCGCAGTTGCGTAGCCAACACCCATGCAAATTATGGAATGATGTTGAGGGTCAACTGCATCACTGACCTGCTTTCCCCGTTCT
GGGTCATCTATAGCAATTATCGATGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACACGTTTACTGTTATTGA
GAAAGGTGGTAAGTGTGCTGCATGTTAGAATTACCGAATTCCTGATAACGCTTTTTTTGTTTTTGTGTCTTTCTTAAACAGGTGAAACCAAAACCCTTCG
ATGGAGATATAAGGTACGTAAGTATCGGGTAGTGCAGGAGGAATGCAGTACTCGTACTGGCGTTTCGTGCCCGCTGGTTATCTGCTCATTTGCCATAGTC
AACTACCAAACTTCTATTGTGTTTTGTTAGCTCTACCATTGTTCATTTGCCAGCAGTCCCCGTACTTGGACGTATAGCTCTGACACTTTGGCAATGTGAC
CTGCTAGGTATCTTGTTCTATTCGCGGCGTGATTTATGGTGAAGTAGTAATGCGAACTACCAAGCTATCCCAGCCTACGCAGAACTCTATTTTTTGCCAT
TTTTGCTGGATCACCCGATCGTGCGGTTCATGCGGAATCGAGTGCGGCTGTGTTCTTACCACAACAAGGCATCACATTATACTAATCACCCTTTTTCATC
GATAATTGCTATAGATGACCCAGAACGGGGAAAGCAGGTCAGTGATGCAGTTGACCCTCAACATCATTCCATAATTTGCATGGGTGTTGGCTACGCAACT
GCGGTATAAAGCGAGGGGTGACTATTCGGAGTTTTAACCAATAAAATGCAGGGGATTATGAATCTTTCGTGTCCCAAACCGAACACTCAAGCCCGCCACG
ATGGTTTAATCGGTTACAACGAACCAGTATACCAAGAGTTTCAGGTTCGAAATCGGTATTTTTATGATACGTTCGAACCAAACAATTTGGTTTGGTTTGC
TTCAGCCCTTTTGGGTTCGCGTGTTGACCTATTTGGGGCGTACTGTCATCTGTTTACCCAAATGGAGGGCCTCATCGCTAAGGCGATCCCCCTCATGGAC
GACAGCAAATCTTTTTACTTCTTCCTGTAAGTAATCGAGGATTAGAGACGCCTTCGGCACCCCCGTGATTCCTTATGCTCGCGATATGACGATGTCCTGG
AGAGTGTACAGTATGCGGGTGAAGAGTGTAATACATTAGGGATGGGGACGTAAACGCAGTTACCGGTTGAGCGGGAACTAGCATAACTTTCCCGTTAGCG
TTTTTCGCAGCGTACCGACGTTCATCGAAAACCTCGTATTGAACAAGGCAGTGTGAGAGGTTTCAGTTGACGTTAATGTTCGTCAAATTTACGCTAAAAA
TCTGATCTCGATTTTGCCAACGGGAACTTTACGTTAATTGCCGGCTTGCTGGTGAGCTCGGCGCTGGGCCCGCTTCCGCAAATACCGCGCGGGTTTTGGT
AGGTACGTACAGGCCTCCCTAATTGGGGGAAATGGTCCCCATTCCCCCCACTAGACTTATGACGAC