Description :
From Genome Similarity Track
Location :
contig_4:78075- 82904
Transcript NameFunction/comments
g1193.t1hypothetical protein
g1194.t1hypothetical protein
g1195.t1hypothetical protein

Sequence
4829 bases(100 bases per row)
GCAAGCGCAATGACGACAACGACGCCTTCAGCGACGGCAGGCACTACGGATGCAGCAGAACCTCCAGCGAGTAGCGGGCTTAGCCAACCTGTGTCGGCAA
CGATGGCGAACCCGGCGACGTCTGATACGACTGCCCAGCTGCCAGTGGCGTCGACCCAAGCGGCAGGCGGCAGCCATTCGGCGACGAACCTACCAGACGG
TGGTGCTCCAACCGCGACGACGAACTCGGAGATGATCACGTTGGTCAACGCCATCCACCTGATGATGTCGACTGTGGCGCGCTTGGAGGCGCACGTGGGC
AACATGGAGCTCGCGAGGCCGACGGAAGTGACGCAGCCTACCGTGGCAATGGCAGCACGGATGGCGAGTGAAGAAGCAGCGACACCAACTCCGCGGGCCA
CTGCGACGAACGAGATGGCGCGGGCGGAGACAGCGACTCGTCGCACGATCCCGACAGCTCCGGCGGCGAGCAGTGTGGCGACGGCAGCACCAACGCGGCC
CGTGGCACAGGAGCAACCCCGGCATGTGGCAGAACTAGCGGAGACCATGGCCGGCAGAACAACAGCGACGGGGGCACGGACGACACGACGGCCGTCATTC
CCCGGCGACGTGGACGACGGCACCGGCGGCGTTCGACACGCACCACGCGGCGTCAGCGGCGACGCAAGAACGCGAAGGATCTGGAGCTGACGACATACAA
GCCCTCGCCCACGGTGTCTGTCTCGACGTGGATTGCGAAAGTGGACCTAGCGGTGGAAGGCGCGCGCCTCTCCGGCCGAGGGGAATGGACGGATGCTGAG
CTGTATTTCATAGTGGGCAACAAGCTGCAGGGCAACGCAGCTGGTTGGTGGGTCCACATGGACCAAGAGCTTCCGAACGCGGAAAAGACCTAGACGAGGC
TGAAGTCAGCGCTGATGCGGCGCTACGGTGAGCGTCCCGACCAGGCCATGGCAGAGTGGCGGGTATACCAGCGCATGATGTACCCCGGAGAAACGTTTGC
TGACTTCGCAGCTGGGCTCCGAGATCTGACGGGCCAGAACCACGTGAGCGAACGCACGTTGTTGTCGCAGTTTTACCGCAACCTGGACAAGACGACCCGC
ATGTTGGTGAGGCAAGACCCCGTGCCCACGACCCTGGAACAAGCGGTGGATAAGGCGACAGCCATAGACGACCCGAACGACAACGTGGCCCAAGGAATGA
TGAACATTGGGCAGGCGTGGGCAACCGCACCGAACGCCTTTGCCGTGCCCATGAGGGGAACGACTGGAAGTGTAGCGATGGTACCTGGCGTAGGCGTGGG
TGCTGGCCCGACGAGCGAATCCTTGGCGGCGCAGATGGGCACCGAAAGCCAGGAGGTGGCGTTCTTCACCAATCCGCAGGGCGTCTACAACAAGTACACT
GGCACGTGGGACGTGCCGGAAGGGCGATTCTGGAACGGCCGGTACTGGCAACCGACGAAGAAGTACCAGCAGTCGAGGGCGCAGTATGAAGGACGATCCG
GTGGCAAACGTGGCATGGCAGGCGGCGACAAGAGGGCGAAGGTCCGTATGGTGCAAGCAGCCGAAGGCGAGTTTAGTGATGACTCAGCTGGGGAGGCATC
ACCACAGCTGCCGCAGCGAAAGAAGCAAAGACCCGGAGGACGAAGGGCGCGATCCGCGTGACGAAAGCAGAGCCGCAAGACATGGACGCGGAGCAGAAGG
CGAGCAGGTTGCCGAGCGCCGGTACGACGTGCTACGCTTGTGGCGGCACGGGGCACTTCGCCAGAGAGTGTCCCGATCCAGAGGCGAGAGCGCGGAACGA
CGCGTATTTGGCGTCGCGTGCAGCTACGCAAGGGTCGGCGGCGGAAAACGCAGACCGGGCGTAGTAAGGGGATCGCTACGTCCGGGAGATCAATGTATTC
CCCAGCCGGCGGCGCCAAGTGGCATGAGGACGGTAATGGTGACGGGTAGGCGACGAACGCAGCAGGGAGCTCCTCCGCGAGGACGGGCGCCAGGCGGCGG
TGAGCAAGAACCCAGCGAGGTTGAGGAGGGAGACGAACAGTTGGTGCAGTCGGGCGGAGGCGCGGCGGCACACGACGAGGACGCAGTGGCTGTGGAAGCG
GCAGCGAGTGCCCATTTGGACGAAGAACTGGCGGGACGAGACGAGGAACGCGCCCATCGCTATGTGGTGACGGTGCGCCCCGCCATGGCGGTACTGCGCT
ACGTACGACCAGCGGCAGATGACGAGCGGCCTCGGCAGGAAGAAGAACAGAGGCGAGTGACTGAGGAAAGCGACAGACTCCCGACGCGCAACGGAGGACT
GGAGACTGAGGAAGGCGTCGACCTCGGAGCGAGAGGTGGCATGCCTTGTGCTGTGGACGGCGGTGACCTCGAGACGCGTGATGGAGTGCCCGAGTCTGAC
CCCAGCAGTCGACGACGAGGTGTCGGCGGCAAGCAGCGCAGAGTTGGCCGGCAAGGGCGACAGAAAAATGGTGGATGCACACAGCATCGCCAGAATGCGC
AGGATTGCGAAACAGAAGAAGCGCGCAGCCAAGCGGCTGCGAGCGGTGAACGCAGAGCGCCGAAAGCATGCAACCATGACGGACGCGACGGACGTGGACG
CGGTGGTGACTGCGCTGGACAGCGAGCGACGGGCACGACGAGAACAACAGCGGAGTGAAGCGCGTGAAGTGCTCGCGCACCGGCGACAGCAACAAGAAGT
CGTAAGGCTGCCGGCGGACGGGCAAGTGGCCAAGGTGCGGCTTGTCCAACAGCGGAAGGTAACAAACGGCGAAACAGCGGCTGGCAACGACGTGTGCAGT
GTGCTGGCTGAAGACGGTTTGCCGACGGCGACCATGGACGTGGAGGGCGAGCGATTGCCCGTGAAACTGGATAGCGGCGCCAGGTATTTGGTGGCTGGCA
CTGAATGGATGCTGCGGGGCGAACGAATGCGACGACCGGCCCCTGTGGACGTGGTAGAAGGCATTGGCGGCTTCATGTTGGACGTCATTGGCGTGTGGAC
GTTCCACATGCGGAACGCCTACGGGCAGGCGGTGACCGTGGAGGCGTGCATTATTGACGGATGCACGGACGAGTTCCTCGTCGGCGTGGACTTCCTCCAG
CACCACAAGGCGACGATGGACTTCGAGAAGAATGAAGTGCGGTATGATGAGCGACAGCAGCAAGTCGTTATCCCTTTCAGGACTGACACCAGTGACGGTG
GCGCAAGAGTGGCGGCAGTGCGGCTGGTAAGTCGTGCGAAGCTGATGCGTAGTGCGGTGACACCTGTTGAAGTGGCGGTTGCAGCCCCGGATGATGAAGA
CGGTGTCTTCTTGCCCACGATGACGTGCGGATCGGTCATGCTGGCAGCGACGGTGACGACCAGCCGGAACGGCAAGGCGATGGTCCCCATGATCAACGTG
CAGGGCGGCAAGGCCAAGCTCCCTGGCAAGAAGGCGCTCGGGTTCTGGATTACACTTGAGAAGGACATGCAAGTGCTAGCGTTGAATGGAGAGCTGGACC
GCGACAACTTGGACGCGTGGCTGAAAGAGTTGGGCGACACAGAAACGCCGCTAGACAACGAGGACGAGGTGCGAGTGGGCGAAGAGGAGCCCAACGCGCG
AGCAATGGTGGTGCGCCTACTGCGAGCCTACCGTGATGTGTCGAAGGACAAGGGCGACTGCCCACCTGTGACGGCCTTGGATGTGGAGCACCACATCGAC
ACCGGTGATGCAGCGCCAATCATGCAAAAGCGGCGTCGACATGCACAAAAGGAAGAAGCAGTGATCGAAAGCAACGTGGGCAATATGTTGACCGCTGGCG
TGATTGAGGAAGGCAGCGGAGCATGGGGATTTCCCGTGGTATTAGTCAAGAAGAAGGATGGTGAAGTACGATTTTGTATCGACTATCGGGCTATCAACAA
GATCACAAAGAGGGACGTGTATCCTCTCCCTCACATCGACGAAACGTTGGTGGCGTTGGGCGGTGCGCGATTGTTCACAACGCTGGATCTGCGCTCTGGG
TATTGGCAAATTGGTATGGCTCCTGGCGATCGCGACAAGACTGCGTTTACCACGAAGCAAGGACTCTATCGGTTTAAACGCATGCCATTTGGACTTATGA
ATGCACCTTCGACGTTCCAAAGGATGATGAACGGTGTTTTACGTGGGTTGACCTGGCTCACGTGCCTTGTTTATCTGGACGACATTGTGGTGTTTACCCG
TGGGGGAGTTGAACGGCATGTAGTTGAAGTTGCAACGGTGTTGCAACGGCTCCGCGTGGCGGGCTTGACATTGAAGCTCAAGAAGTGCGTGTTTGCTACG
ACGTCGATGGAGTATCTAGGTCATGAACTGAGCGGTGAAGGCGTACGACCGGTGCAACGTTTAGTGACGGCGGTGTCTGAATTCCCTCGGCCCCGAGACG
CGGTCGAAGTGAAGAGGTTCGTGCACTTGGCCGGCTACTACAGGAAGTTCATCGAGGCCTTCGGCTCGATAATGGCCCCGATGACGCGTTTGCTGAAGAA
GGAGCACGATTGGGAGTGGACGGAGGCGCAGGAGTTTGCGTTCGAGCGCATCAAGGCGGCCTTGACGAACAAGCCTTTGCTCGTCTACCCGGACTTTGCT
CTCCCTTTTCGCTTGGTAACGGACGCTAGTAAGACAGGACTGGGTGCTTGCCTGATGCAAGACCAGGGCCACGGCTGGCAACCGATTGCATATGCCAGCA
AGGTCAACAGTAGTGCGGAGTCGAACTACTCGATCACTGAGTTGGAGTGTCTCGCGGTGGTGTGGAGTGTCAAGCTGTTTCGGCCCTACCTGTACGGTAG
AGCATTTGTCATAGTCACAGATCACTCAG