Description :
From Genome Similarity Track
Location :
Scaffold_40:78074- 79545
Transcript NameFunction/comments
Phypl_g1551dynein heavy chain

Sequence
1471 bases(100 bases per row)
ATGCCACAGCGACTGACCGTTGCCAGAGTGGCGTACCGCAGTGTCTCCGTTTCCATCATGATCCATACATTTGGAGGAATCTCGAGACGTTCTCCTGACG
GAAGCGTTAGCAAGCGGTTATCATCTAGCACAGAGTTCAAGTTCTCAGCCCACTCTGGGTCCACGTCGCCATCAAAAATGATCCAGTGGCGTTTTTCACT
TTCACCTCTGACGCTGTTAAGCACCTGCCGGAGCAAATGTGTGAACACACCGTCCGTCCACTCAAGCGTTGTGTTATCAAGAACGCCGTAGAGGTGCTCC
TTCGAAAGAGCCTTCGGATCAATCACATGTGCTTCGCCCTTTACACCATTAACAAGTTCCATAGCATTCATCAGCATGCGCCACGCACTCGACTTTCCTG
TTCCAGACGCGCCAACAAGCATCACgccgtggcgaagctgcatGACCTGGTAGAGTTGCAGAGCCTTTTCGACCCATTGGTCGTTCGCAACGTAATTCTC
CTTCTTTGCCAGTTCAACGATCTTCGCACGAAGGTTGTCTTCTTCAATACGATGAGCTTCAGTGCCTGGAAACACTCCCTTCAGAAGCGTTTCAAACACA
GGAACATCGTTTGAAACGAGCTTGGGCAAAATCGTATCAGTAATGGAGCCAATCAACGCCTTCGTTTCCAACTCTTCAATGTTTGCTAGAGCCGCACCAT
CCGGCGATTGAGATATTTTTCGCTTGAGCTGGCCAGCGCTTACAAGCACACTCTTCAGGGCACGAAGTCCGAAGTCATAGTGCGGCTGCTTGGACAGTTG
GTCTTCGCAGAGGTTGAACAAAAGGACGACCTTGGCAGAGATTTGTTCAGCCGTGGTAATACCCTGGGAGAACAGCATCACCTGTGCGATCAACTCGCGA
TCCGGGGCAACCATTGCAATGCTCCGGAATAATTGCTTCAAGTTGTCCGGTAGGTTAGACCGCCCAGCGTAACCCGGGTTCATTGTCACAAAGATACCCA
CATCGGGATTCAGCTTGACGctcttgcccagcagctcaatcGTAGCAGTGGAACTGCCGCCATTCGTGAGCGCCTGCGAGCCGTCAGTCGTCTTTCCGAC
CTTCAACGAGGACACTCCACTCTGGATCGCTAAGATTTGCTGGGACACAGCCGAAAGCACACGTTCCTCAAGGCGGTTAAACTCATCAAAGCATCCCCAA
GCACCAACTTGGCACAAACCCACAAAAATTCGGCCCATGGCCTGGAAATCAAAGTGCTCGTCACAGTTGAAGACCAACACAAAGCGACCCAGATGGGATC
CCAAAGCCTTAACTGACTCTGTCTTACCAGTGCCGGCAGGACCAAATGGATTTCCTCCCATTCCGAAGTCCAGCGCCTGAGTCAGTGTGAGGTAGCAACG
TTCCGTAAGAGGAGTTTGCACAAGCCTCTCACCAACGCCGAAGTACTCAAATCCATATGAAAAGCTGGCGT