Description :
From Genome Similarity Track
Location :
Scaffold_206:78064- 83500
Sequence
5436 bases(100 bases per row)
CCCGTTACAACTGGTAGCACTTTATAGTCCGTCCAATGACCACAACCCCCGCATCCAACATGAACATCTTGTATGGTGATGGCGACAACATTCACACCAC
GCGTAAAGCTACTCCTAGTTGAGTGACATCGAATGGAGTGCGGTCGAACAGGCTGTCTGTGCCATGCTGTCCGCACTGGACAGAGATGGGCAGCATGCCG
CCGTCGTCAAAATCATACAACATGAACCTGACGAGTCACGGGAGAAAGTAAACCTTGCTTCACTAGCAAGGTTCTCAACAGGGATGTTAAGAGAATGGGG
TGCTCAACAGTTCGAACTGTTGCGACAACAGCAGGCACAAACTTTTTTTTTCCGGGGCGACGCGCGTGCGTGTACCCGAAACCTTACAGATTGACATCTC
CAAGTACAGAAGAGTCGAGGAAGACCCCCTGTAGAGATGTTTCGTCGAGTTAGGCGACGCCATAAGAGCTCGTCACATCGTTGATGAGCAAATGCAAGTC
GCATTTGCTGAGTCGAACTTGGCAGGACGTGCCAAAACTTGGGCACCAGATCTCAATTTGCACGACACGTACGTATGTGGGTCGTAGGAGTTATTTAAGT
CCTGGCTCAGAAAACGTTTGAACCGCAACGGGATGATTCCACAGCTCAATCAGAGCCTGCGAACCTTAAACAGGGTAAGCGTAATGTGCAAGCTTACGCC
CAACACATAAGACTCCTTGCGAGCTGTATTACGATCAACCTGGTCCATAAACACACGTTAATTACGGTGTTCATGCAGGGCATTGCGGATGGTCCCGTCG
AGACCCACCTATTCCGCCTGGAACTGGATACGCTAGAAGAAGCAATATCAGTTGCGGAAAACCGGAAGAATTTTGCTTAAGGTAGGCTCATGCTAGTTCG
GGTTCATATCGCCCCTTACTAAAACGACAAGAAGTGGGAGGTCCAGAACCTATGGAACTTGGTAATGTTGAGAGCGAGAGACCTTGCTCTTCGAACAACA
AGCGATTGCAAAAGTGCAATCGCTGTCAGAAATAGGACACTTCGCCTACGAGTGTAGTGCCCTACGCACAGTGTCCCGAAACACTGAGCGGACTGATCGA
CCGTCTGCCAAGAAGGGCAACAGACGCAGGTCCAACGTTGTTGCGAAATCGCAACAATGAGTGGACCGTAAAAAATGGTCGGAGTTAGAAGAGGCGGAGC
GCCATACTGATCTAGCAACCTCAAGAGAATTTGCAAATATCTTGATGAAAGCTGTACAAGACTCACACTCATTGTGTGTCTGCACTTGGTGAAGACGTAA
ACCTCATCACCTTGAATTTGGAAGTGACAGAAGAGTTGTCACTTCTTGACCTAGTTGACTGTTGGGCATCGAACAACTTTGTTAGTCGCCAATCGCTAGA
GGTTCGTAGGCTCAAGTTCGTTGAGCACGACATCCCTCTAACGAAGATGACGGTGCGCCTAGCAACAGGCGCATCGATAACATTGATGAAACGTGTAGTG
GGACTTCACAACACGCTGGAAGATTTGCAGTACGATGATGATTTCATCATACTATATTTTGATGACAAATTTGATGTCATCCTAGGGTTGCCTTGGCTCC
GAAAATACGAGCCAAGGGTTAGCTGGCAGCATCGATCCATAAAGATGCCTGCCACTTGTTTATCAGATGGACACCTGATGAATGTCTTGGAGCATCCACA
AGCGTGTGGATGTACTACGAGTGATTTCGATGGTATCACTTGTGGAACGGTCGCTAGTACGAATGCAAAAGATTGCAGCGTGACAACGAATCACACTGTG
GAGGAAGCTGTCGGCGGCTGTGCGGATGCACATGCAGCGCCGAAGGTCCACCACTCGAACAAGTCGAGTGGATCGGGACATGGGTGTACGCCTAGCGGGC
GACATTCAAGGAAAAATAAAATTGTTGCCAACACAGGGCAACACGATGATCCTAGGTAGACTGGAGAGTCGACCGTAGAGGACCTGGCTGTGGTAGCGCA
ACCACAGCTAGAAGACGTCGAGGAAATAAGTCCTCACGTACTTGAGGGAGAAATTCCTCAAGCGGATATTGTTGAGTTTATGAGACCTCATCAATAAGTC
CCCAGAAGCCAGTGGAAATAGGTTTTCAGGAAGGAACTGAGACATTGAATGTCTTGGTTAATGAAGGGTCAAGTGTAGGCGCTTATACACTTGATCTGAT
CGCGCCTCCGAAGTTGAATTCGGAGATCACTCAGCTACTTACGCTAGAATCAAAACGGTTCTTGCAAGGTCTGCGTAGTGGCAAGGTCAAGCAGATCTGC
GTACTCGTCGCAGAGGACGATTACGTGATCGATTCGGTCGGTAGTAGTATTCGCCGAGAACGAACGGGTTCTCAGCAGCTCATCGATGAAAGAAAGTGTC
CTCGATGAGAAGACTCGTATTGAACAATACATATCTCAATCTTGGGAGTCGACGCAGTCAAATCCTTAATATGAGGATTTGATCGAATTTAAGGATGTGT
TCCCTGAATCCGTACCATGCGAGTTACCTAAGGATAAAAGCGCTCGACATGAAATCGAGCTTAAACCGGGCTAGAAGTACTGCGTTATGAAGCAGTGGTC
ACTCGCTCGTGAACAAATACTTGCAAGCGACAAATTCATTGCCGATAGCTTAGGAGAGGGCTAATGTGATGGGGTCAGCCTCCCCACATAGCTCTCCGAC
CTTCTGTGTGCGCAAGGCCACAGGAGGATGGTGGACAGTGCATGCATTTAACAAGTTGAATGCTGCAACGGTACCGGCGCAGACGCCAATCCCGAGGAAG
GACGTCATCATAGATGGTATGGTAAGGAGTACCACCTTTTCGTCCATGGATCTTATGAATGACTTCTATCAGATCATTATGCGTGATCAAGGCATCCCGT
ACACAGAAGTGAGCACCACTAGTGTTATGCTCTGAGAGCGGCTAGTAATGCCACAAGGGCTGAGCAACTCCACCGCTACATTCAACAGATGCGTTACGAA
TCTGTTAAGACTGGTGCGAGATTTCGCACCGAGTTACTTCGACGATGTATTCGTCCGTAGACGGGCTATGGGCGGAAAGAAGGACGTGGAAGTTCATAAA
ACACACTTTCGTGAGGTTATTACAATTACGCAAGCATGATCTGTACGTTAAACTCAAGAAGTGCGTATTCGCTGTGAGTGATATAACACCTCTTGGATGC
ATCGTGGGTAAGCACGGCAAACGCCCTGATCCGGAAAAGATCACGGCGATTACCGACTGGCCTGTGCCAGTCGGTTTCAAGGGACTTAGAAAGTTCCTTG
GACTAGCGGCGTTCTTGCGCAAGTACTGCGCAACAATGACGTGATGACCGTTCACCTCTCTCTTCTCTTTAAAAAGGACGAGAAATGGTCATGGTACGCT
GATTGACAGCATTCCTTTGAAGGTATCAAGCAGGAATTGATAAAATCGCCCATCTTGGCGATTGTAGATCAGGACAAACCATTTCATATGGTCTGTGACG
CTAGCGATTTCTCAATCGGCTGCGCGTTAAAGCAGTATGACGCAGACAGCGCAGAGCGAGTCGTCTGTTATAGTCACTCCAGCTGCTTGCAGCTGAGCGT
AATTGCCCAGTGCATGACAAGGAGCTCCTTGCCATGAAGTATGCACTGGCTAAGTTTCGCGTCTATCTTGTAGGAGATAGACCGCTCGAAGTCTTATTCG
GACCATGCGTCATTACGCACGGCCGTAAACAGTCCACACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCAACTTCGCGAGGTACTATTCTCCGTAGAATG
TAAATTAGGACGACTTAGTGTCGTTTCTTATGCGTTGTAACGACGACCCGATTTCGAGTCGGCTGCGCAATCCAACAGTGGGATCAGCATTTCTGTTACA
ACACTAGTTACAAGTGTTCCGTCGTCAACACTGGTTGACGACATAAAGAAGGCCTACGCATAAGATAAGGCTCTTCTGCGACTGGTGGATCATCTGGTGA
ATCTATCTCGTATCTCTCTCAAAGATTTACCCGCCTTGTATCGATCCGCCGCAGATCAATACACAACACACAACCGGTTGCTGTATTACAGAGCTGTTGC
CGGCGACACACCTAGTATCGTCGTTCCTAATTGTAACGATTTGCGCAAACGCATCATGAATGAGTAACAAGATGCACCAACTAGTGGGCATAGTGGGCGT
AAGAAGACTTGCCTCACGCTAAGACGTGACGTTTTACTGACCTCGCCAATATCAGCTTGTGCTCAAGTACATTCGTGCTTGCGAAGTGTGTCAACGGGTG
AAGCGTAGTCCTTCATCTCGAGCGCCACTACAGCCTCCACCAATCTCGGCAGAGTGCTGACAGTCCATTTAATGGACTTAGGCTACGAATTCCCCGAAGA
CGCACACAAGAATAATGGTATTCTTGTGTTCATTGATCGATTCAGCAAGATGGTACACCTTGTTGCAGTTCAGGAGTCGATCACAGCACAGGGATGTGCC
CGTGTCATTATCGACACAAGCTTTCGACTCTACGGGTTACCTCGTGAACTAGTCTTTGACAGAGATCCACGGCAAAGTTTTGGCAATCCGTGTCCCGATA
CTCGGAACACGTCTAGCTATATCCTCATGCTACCATCAAGAGACTGATGGTCAGACGAAACGCGTCAACCGCTTCTTTGAAGAAATTCTTCGCGGGCACG
TCCAATCTTTCACAGACTGGAGTGAATTTTTGCCGACCGTTGAGTTTGCCATCAACAACTCCGTGCATGCGTCCACAACGCATACACCGTTCTTCGTGAA
TAGCTTGCGCCATCCACGTCTACCCGCCCAATTAGAGTGTGACTCTGGTTTAAGGTTGGAGGAACTCGCTAGAGCAAAAACCGCTCTGGCTTATGCTCAT
CATGTGTGGACCCCGACAACGAAAAAGTTTCTGATGTCGATCAAATCGACATCAAAAAGGATAGCTTCAGTAATAGTGACGAATCTATTGATGATTTAGA
TGATGATGACGATGCTGGTATATTCAGTATCGATAATGATTACACCAGCGAACACCTTCGCTGAGGAAGAGAATGATCTCTTAGCAGTGCGCACTAGGCG
CACTGCAACAAACAAAGGAGAGTCAGCAGAAAGATTCTGCTGTCACGAGAATCAGTGGTCCATTTCGTACAGGACTCCATTGCTAACGCAGTGGAACTTA
CAGAAACGGACGCTGATAAACATGGAAGAGCAAAAATCCTTTTATTTTAATGTTAAAGACTTAGTCCTTATGTTAACGGTTAATCTACCTAAGCACGTAG
TAACTAATGTGGGTAGTAGTAAATTAATACCCAAGTACATCGGCCCGTTTCGTGTATTAAATCGCCAAGGCAATGCGTACACGATCAAGTTGCCTCGCAG
GATGCGTACGCGTCCTACGTTTTATGTCGGTCGTCT