Description :
From Genome Similarity Track
Location :
contig_100:78045- 79173
Sequence
1128 bases(100 bases per row)
TCGACGTGATTTCTTCGCAAATCCACGTAAGTTTTGAGTGCTGATGGTTAAGTTGGTTCGAGGTCCTAGTTTGTGTCGTCGTGTTACTGGTGGTTGTTCA
AATAAAGTAGCTATGTTGTGTAGGTCACTGTAGTAGTCTCCTTCCGGAGGGTTGTTGTTCGGTAGCTGATTCATGGTTATTGTTGCCCTGTCGCTTTCTG
GAATAATCTCGACTCTGTTGGGAGATGTGAGCAGTTCTTCGATCTTGGCCCATACCCCAGCTGTATCCTGTTGGTGGATAGTTGCGTTAATATCTGCATT
CTCTTGCATGACCTCAAAGAGTATGTCGAGGTACTCAATTGTGGTCGTGGGTTGTCGGCCTCCAAAATTCCTAGTTAATCTCTGAGTTCATTGGTGTACA
CATGTGCTGCTACAATAATTCTCGACAGATATTTCAGTCGTCCCTTACTGCAGAGTTTGAGTAATTCCATGTCTCCACATTTCATCAGTTTCAGTTTCTT
CCATAGTTCAGTCGGGAATAGGTTGAGTTGTTCTTGATTTAGCGCTGCTTGTTGCTGCAGTTCTCCAATACATAACTCCAGCCAGTTTGTGCTGGCGCTG
TCTCCTGTTTCACCAGCTTTTTCCGCCAGTTGACCCAGACAGTGAATCAGGCAGTCCAAGCGAGCCGCTGTAGTCCAAGAATCCAGTACTGCGTCTGTCA
TCGTTGAGAGTATGAACTCTGGAGATTGATACTTTCTAAGCGTTGATAGCAAAGTCCCTGGAGCATGCGTCACTACCGATTTCCATGTCTCCGTTGTTGC
TGGTAGTGTAGGGAATGCTGTTGTGGTCTCCTGTTCCCACTTCGGTGCTTCTTTGTGCCACAGCTTCCGTAGTTCTCTTTGGCGAGCCCTACTAGCACCG
ATGGTAGTATATTGGTTTCAAATCGGCTTGGATGTGGGTTTATTGTGCTGTCTGCTCTTTGGAGCTCGCGTCTGGTAGGATTTCTGGGTCGTCTTGTTCC
CATACCGAGCTGCTTGAATGGGGTCGCTGGACGAAGTAAAAGTAGATGATGGTCCTTTATCCAGTAGTTCATCTTGCCATTGTTTTAGCGTTGTTTGATC
TACGTCGTACCGTTTCATCCATTCTTGC