Description :
From Genome Similarity Track
Location :
Scaffold_844:7803- 11624
Transcript NameFunction/comments
Phypl_g11262hypothetical protein

Sequence
3821 bases(100 bases per row)
ATCCTTTCGCAATATCGCCCGCGGTATGGGATACACTGGACGCTCCACTGCTGGTCCTGGATCAGGTAGGTCTGCCTCCGGGGGAACGGCCTCTGCCGTC
GCTTGGAAAGCCCGATTCTGCCATTCATTATAGCGACGCGACCCGATCTCCAGCTAGCCACATCGCTATCCGTACATCCTGTTGGAGGATGAGGCGGCGG
GCACTGATATTAGTGATCCGCAGGTATCGGCGTCTTCCAGGTCCTCCCGTCACAGTCGGCACCCAGCGATCACCGCGTGTAATCCATAATTTCTCTCGAT
CGGATAACGCACGTAAACGTATAAAAAGTCCACACAACTCCCCGATCTCGATCTGGAGATGTTCACCTATCGTCACCAGCTGGACTCGATCATTGCAAAG
CTGCCGTCGACCACTGAGTTGGATCTTGATCTCATTTGGTAGGCAGATTGACCCATCTGCCAGATCAAGTGTGATCCCAGCGGGGACTATGAAGTCCATC
CCCAAAATCGAGTCTTGACCCGACAGATCATCCACTCAAATATCGAAAAAGCAGACCAGCGACCCTGTCAGGGTGATCTTGACCCGCGTCTTTCCTTCCG
TGACGTACACGTTTTCGCCGATCCCGACACACTCCTGACTCTGACTCCTATCGACATGGTACCCAACCTTACGACCAAAGGCGGTGTCCACGATGGGCAC
CTGGGCACTAGTATCTAAGAGTAAGATCGCCTTGTCATTGTTGATCTTGCCTATCGGCTTCGTCTGTCGAAACCTCTTCCCGGGGGCATGATACTTCCAG
TAACCTCGGGACTGTCCTGGTAGGATATCTAAAGACATCATGACGTCCGATCGGCAATATTCATCGACCTGGCGAAGATTTGAGATCACAGCAGTTCGTT
CTCATGCAGATCACATGTATTATCGCGTAGATCTTGTTGCTGATCGCTGACTTGATCTATCGACTTCATGTACACAAATGCATAAATGCAAAACCTAGAA
CGCTCGGCTCGTATTGGGTTCCAACCCGACGAGCGTCCTAGTTAACATCTTCTCAACCCTTGCAGGCAACACGCCCGCATGCTTGGGAGGATTATATCAC
TGACGGATCTGGTTGTAGCATTCTTCCATCGGGCACTTCCCTATGTCGTGATGCTCTCCACACCCGCGACACACGAACAGACAGTGATCAGCAGGGTGGT
CTCGCTTACCAAACTTTTGGCAAGTCAAACGTTTCCAACTGCCCAGATCCGTATGCTTACGAGAACcacagcgcgagcagcgactgcgatcCGATCCGTC
GGGAGGTAGCAGCGATCTGCGACCATTGGGCATCTGATCTGCCGCGATCCGACCCGGTGGTAACCGATCCGCCTGGGCTGGCTCGCCCCCTGCCGGAGGT
GGAGTAGCATCTGTCGATGCAAGGTAGATCCGACGTAGATTGCCCTCTGAATGAGATCCTCCGGATCCGTCCAAGCTGGAGTCCGATCCCGACGGAGGAT
GTAAAGACTGGATCGCGCGTACCGCTCTCTTGGCTGGGGCGGCTGACGCAGGTGCAGGGTAATTCTGCCGATACTTGGATCCGAAGGCCGATCGCTTCTG
TCTACTCTTCGCccgttctcgagctcggAGGACTTCATCCaacgcgtcggcgtccgaaAGGCGTAATAGCGTCAATTGGTTCGCCAGATCCTGATCTCGG
AGCGTTTCGATGTAATGATCGACGTGCTCGCGGCGGTCCTTTCGGTCGCCGTCCTTGATCTTCAATCGTGCACGTAGACTTGCCACGTTCAAATGGTAGA
GATAATCCAGCGGTGATTCATCCGATCGCTTGCGAGCATGATAGTACTGCCATGCGACCGAGACTCCAAGTCCGCAGTACTATACTTGGAAGCTGTGAAG
CAGATCGCTCCACTTGTTCCGCGTCGATCGACTCAACTGGCGGTACCAATTGTTGGCAGGTCCGGTCAGCAAGTCTGAAAAGGTCAGGCACATCTCATCA
TCCGAGGCTTGATCTCGTAGGAATGCCGACTTGACCTTACTGATCCATGATCTAGCACGGTCCTCGCCTTGATATGTGTCGGCAAACTCTTTCAGATCTG
AGAGCGCTTAGATTCGGACACACTGGATCAGTGAAGATCCGCCCGCTCTGCCTGAtacggtggtggcggtcgtCACCACTGCACGGTCAGAGCTCGGCAT
ATCGAGATCGTCCGGGTCGTACTCTCCATGAGATGGACGATGGTGTCGCGATACCACCGACTCCATGTCCacatcttgagctccagcataCTTCGGTCGA
TCTGCCGCTCTCGGCATGATCGTTACCTGCTGTTCCTTCAGGAATCGGGTCATGGGGGCTTGAGAGTATGGCTCGAGCTTATCCTGCGGCGTCACCGCAT
CCGTGATCGGGATAGCTGGGTTCGGTGACTTCTTCTGTCGATCCGCCATGGACGGTACACGATCGGGGAACTTCAGCCGGGATCGCAGTAGCGCTGCACC
GGAAGGTCCTAATGATATCCGTCGTGGGACGCTCGAGCAGTCCGAGCCTGGCTCTGAAGTGGCCGATTCGTAGTGCGATGATCCCGTCTGGACTTCGGTG
GTGGACAGCTGTCGATCTCGCATCACAGGGGTTTCACCCACTAGGAGCTGCAGTGTCTCGACCAGCTTATGCGTTGCGGATCGGATTACCTCCAGATCTA
TATCGAACAGGTCGTTGGTATCGAACGCTCCTGCCACCAGAACAGCATCCTTGAGTAGATCCAGCAAGACCTTCACCGCATCCAGCTTGTTCGACGTCGC
CGGAGGGATCGCTACCGGACCCGTCCGATCGCCAATCAGACGTACCTGCATGATCTGCATCACCGGACCATGAACCAGGAAATCGCGTAGGGTCTTGTGA
TGATAAACGATTTCGATCGTGTCTACCGACCACGTCGCTGAGAGTGTCACAGTCGGATCCCCCGCATCTGACTCTagcgccttcagcttcatctttGCAa
ccttgctcttcttcttcttctgcaacgACCTTATAAAAATAGGAGTCGTGAACACTTAAGATTCAGGCGTGACCTTCTTCTCTTCACTGGGAGTAGTGAA
CGAGAAAGGTTCAGGTGTGATTTTATTGTGCTCACTCGGCAGATCTCGATTCTCATCGAGATCTGCGGCGGTCCCCGAAAGAACCTGGGAAGGAATTCGA
GGTATCTCTTCTAGATCCAAATCCGGTTCGCCCTCATTTCTGTCAGCCGAGATCCTCCCAGGGCTCCGCCGATCTGCGGATCTTGTTTCATTcagcggca
tcttcgtcgaTTCGATATCCGATGGCGCTTGATCCCCTTGTTCTTTCTTCACTtgcgcatcttcttctgggAAATCACGGTGAAATCCTGAGTCACCAAG
AgatccgggcacgcgcacAATTGTGGTGTAGCGGGATCGGCCAAAACCGCGTTAAGGCCAGATAGAGCTTCCCAACAgcgcccagacaccgactaacgga
gggggtcTCCCGATGTTCTGTGGTCTGCTGAACTTGTTCTCACCTTGTGCACCCGTAGGTGGGCCTGATCTGCTCTCTGGGGACTCCGAAGGATGTAGTG
GTGAAGCGTAGAATGTCTTGCGTGACACGGGAAggggtggagcagcgcggaagtcttcgctctgcgtcCGAGTAGTTGTTCCTGATCCGGAGTGAAtcga
gcgagcgagctccGATCTGGAAGCCTGGACTTGATCCGAGGCCGGGTTGCCTTTAAGGGTATGAGCCTTCCTTTCCGTGagttgcttgctgcttcctATA
GCNAGTTGAGAGTCGAAGCGA