Description :
From Genome Similarity Track
Location :
Scaffold_300:7803- 8820
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_300-fgenesh-gene-0.6Hypothetical cleavage-induced protein
Pytir_DAOMBR486maker-pir_contig_300-snap-gene-0.15Gene of unknown function

Sequence
1017 bases(100 bases per row)
CCTGGTTGTCCTTCTCCGTACCTTCGAGCGTCAACTTGAGCAGCGCGCCGTACGACGTGAGCGCGATCCAGTTCGCGCTCGCCTTCGCAACGTCCTCAGC
GGCGACAGTCACGGCCTCCACCACGACCGCGCCGGATGGGCGACCAAGCTTCTTGTACACGTCCTTGGCGACCGCAGCGAGCGCGTCGCCCTTCTTGCCG
CTGTCGAGCACCTCCTTGATGATCTTGCGGTCGGCCTCGGCCTGCTTCGCGGCCTCCTCTTCTTTCTTCTTCTTCTCCTCTGCAGCGACGCGCTTGGCCT
CCTCGGCGGCGAGACGCTCCTCCTCCGCCTTCTTCTTGCGCTCCTCGCGCATCTGCTGGGCACGCGCCTTCTTGTCTGAGATGGCAGGCTCCAATGGCGC
CGCGTTGCGCTCCTGTGGCTTGTTGTCGTTCATGCGCATGTTGCCAAACGAGTTCGAGAAGCGGTCATCGCGAGCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCCCGAAGCGGCTGCCCGAGGCACCGC
CGCGCGATCCAAAGGCGCTCCCGAACTTGTCGTCCGAAGCACCGCCCGAGCGGAGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTGCGGCGCTGG
AGGTTCAGACGCATGTGCGATGGACGCTCCTCCTCGCGAGACTCGTAGCTTGGACGGTCGTAGCGGGATGGACCGGCGGAGGCACCGCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCACCACGGTCACCGAAACGGTCTCCGCCACGGTCCCCACGCCACTGGCTAGACTCG
TCGCTGCGCGAAGGCTCGCGCTCGAAGCGGTCACCGCCGCGACGGTNNNNNNNNNNAATGCGTGGGCCGGACGGCAGCGCCGCCTCCGGCGTGTACGCCA
CGTTGTCGCCGAGGAAC