Description :
From Genome Similarity Track
Location :
contig_25:780149- 784175
Transcript NameFunction/comments
g5044.t1hypothetical protein PHYSODRAFT_560159
g5045.t1hypothetical protein PHYSODRAFT_498950
g5046.t1conserved hypothetical protein

Sequence
4026 bases(100 bases per row)
CTCGGTGTGCTTGTCTTTGGTGACCAGCTCCATTTCTACCTGCTTGAACGCGGCCACGTAATTGTACTTCTCATAACCCAGCCTGCATGGTGAAAAATGT
GCGAGAGCAGTTAGTCGCTTGCTCAAGAGCAAAACAGCACGACATGCAAACTTACTTTTCGAAGAGCTGCAATGAAGCACCGTTCGTCTCGATGATCTTG
CAGACAAATCGGGTGACGTGGAGCTTCGACGTTGCTGTATACGGGGAAAAATGAAGAACACAAGAGCTCGTTGGTCTCATAACTCAGCCATCCACGACAC
TGCTTCATACCGTAAGCCATCATGAGCTTCACTGCCTCCTCCGCAAATCCCTTGCGGCGATACTTCTCCTCGGCGATCATGATCTCCATCTCACACGCTT
TGGGGTCGTCATAGTCGTTGAAGAACAAGTTCACGTCCCCCGCCATGCCTGCAACCACCCATTAGTCACATATCGCGTCTTCCACCATAAAATCTCCCAC
ACAGCAACCAACTCACGGTCAACGGCACTCTCGTCGACGTACGAGGCGCCTGGTTTGCCGTCACCCTCGGACTTTTCCAGTACAATGAAAGTGCACTCTG
CCAAAGGCATCAAAAGGGTAGAAACTAAGTCCACACAAAACTATCTTCGGCATTGACAGCTCGTACTCTCGGCATCTTCTCTCCACGACTTTTGCATCTC
CAACTCCTCTTCGATCGACAGTGGCTCCGACGCCGTCATCTCTGCAGCAAAACAAAATCCATGAGAGATCCACAAAAAATAGGTTCACACTACTGCAAAA
TGGTCGCAATTACCTTGCAGCCACGGGTCCTTCATCCAGTTGTGGTACTTGGCCACATGCTGCGTCTCGTACGGCACCAGCGTCACCTGCTGCCCAGTCT
GTAGACAATATAAACAACACCGAACAATACTCTTCATTAGCTTCCATTGCACAATAATATAGGTACTCGTCAATGCACTGGCCGTACAATCACAACACCC
GCGTTCGCCTTCATGTTGACAAGTCTCACACTGCGGCCAGGAGCTAACTTAATAATGGTCCAATCATATTGTTTTTTACCTTGTATTCTAGAATATAGAT
AATGATAGATTGTAGGATTAGCTAGAAGACGTGACAACCAGATCAGAATGAGTGGCCTCGCCGCGCTCGAGGTGCCGTTCACGGAGGTTCTGCTGATGTT
ACTACGCCACGAGTGGGTCGATGTAATGTGCCTCTCTCTCCACTTTCGACTGGTAGAATTTTCGCTGCGTACTGACGTCTATGGGCGCTGCAATCTGCAG
GTGAACGATGTGGAGGCCGTTGCTGGAGTGAACAGGAGCTTGCGATCCGTCGTGGAGACTCGCAAGCTGCGACGTCTAGCGGTGCGTGCCAGCGGATTCC
CCAAAGCTTCAAGATTCAGGTACGAGGTCCTTATAAACGCAAGTGGGGGATGGTTGGTTCAAGCTCACAGGTGTCCATGACGTTGAAGCTACTGGCTGCG
AGCTGGGGACGTGTCAACGCTCATGAAGGAGATTCCAGAGGGGGCGAGCAGCCAGGATTTGTTCCTCAAGGTGAGGAGACTGTTGAGCTTTGTAGGAGGG
CGGGGGCTCATGACGTGCTGTGTGCTGTGCTGCAGCTGACGGGATGGAGAGGTTGGAGGACGAGGCATCGCTTGAGAGCACAGGCGTAGAAGGTGGGGAT
TGTGCTGGAGACAGGAGAGATAGAGGAGAGAGTAATGGGCGATTGGTGATTGCAGGAGAGATCGAGCGCGATGTAGAGCGAACTTTCCCAGCGAACCCCT
TTTTTTCGGACCAAGGTGAGAGCTGTGGTCGAGGCATCAAGCTTCTGCTGGCGTTCCTCTTGAATTGACAGTGCTGTTTCGTAGGCGACGGTAGACGGAT
GCTTAGCAATGTGCTGAAGGCGGTCGCTCATCATGCAGACGACGTTGGCTACTGCCAGGTGCGAAGCTGGACGGTGACTGCAAGTAGAGCCGACCAGCTA
ACGACAAAGATGGCGCTGTGTGCGTTGCTTATCAGGGGATGAACTACGTCGTCGCTGCACTGCTGCTTGTGATAAAAGATGCAAAAGATACTGCTGACGT
GGGAATCGATGGACTCTCCCTGCAAGAAGCGGTGTTTTGGCTAACGCTGTCTTTGATTCGGCGCAAGGGGATGGCAGATTTGTGGAAGCGCAAAATGCCA
GGGTGCGTTTTATCTGGTATTTGGAGCTGAGACTACGTGAGCTAATTGCTATTTTGTATGTGGTGATGGTGCAGACTTTCCCAATGTATTTACCTATTTC
AGCAGCTGCTTAAGCTTCACTTTTACGATCTATCAGCGCACCTCCGACAAATTGGGTTGCACTCTAATATCCTAGCCACGCAGGTAAGAACACTGGGAAT
GCGGGTTTATTCGAATCTTTGACATTTCGATGTGCAGTGGTTTGTGACGCTATTTGCTCGAGTGCTTACACTTCCTACACTTGTTCGAGTGTGGGATCTC
TTCTTTATGGACGGGTGGAAAGCGGTATATCGAGTCGCGCTCGCCATTACAGCAGAATTGCGACCAAAGCTTCTCATGATGGTATGGTGACGCTGCAGCA
AACAGTCACCTACGTTTTCTGATTGCGCTCTATCGTTTTGGTTTACCGCAAAACAGGATTTGGAGCAGTGCAGCGAGTTTTTCCGCAAGAACCCAAAGTT
GGGCTTGGAAGAGGTATTTGGTCCAGGAATACTGCTGGAGCGTGCACTGGAGTACAAAGTGACGCGCTCAAGCCTGCAGCAACTGGAGGAAGAGCGACAT
CTCGAGGTAAGAAAGTCTTGGCCAGTCTTCTGTCAGGACAGATTGGTAAGCTGGTTGTGTATTTCACGCTTTGTTAGTACTTGCGTCTTCGACTACAGCA
AACTCCACTATCCGAAGAGCATCGTATGCTGTTTCCTGCCCTCGAGCGTGAAGGCGATGCTGCTGCACAGCGAAAGGCTCTGGAGCTGATCCGTTCAAAG
CTGAAGCGTTTCGACTCGGACGTCGCGAGTGACACAATTATTCTTCAGCAGAAAATCGAGGCAGCTGAGCGCGCGCAGGCCCAGGCGATGTCAGTTCGCT
ATGCCATTGCGTACGAGCTGTCCGAGGCTGCGATTGAGCTGAATGAGCGTGTCGAGGTGAAAAACCGACTGCGCTCGAAGTTCCGCAAGCTCATGTCAGT
CGCGATTGCAGCAGCTTCTTCGTCGTCGTCTTCTTCAGCAAGGTCTTCTGCGTCAGTCCTTCCGAGCTGGGTCCATCCGTTCGACTTCATCAACGAGCGA
ATGGCCAGTTGCTTTGAGCGTCTGCCTCTGATTTCCAGCTTTACCGACAGCGGGTACATCGACACCGACGACGAAGAAGACGAAGAGGTACAACGGAACT
TGGTGCATCTCAATGCGCTGGTGCCTGAGATGGCGGCAGAATTGCGTCTCCTGCAGCGCTCGGTGGCCTACAACGAGCGCTTTCTGCGTCCACTGCTACA
GCGGACGAGTCGCCTTCAGCGTGACGCGCAGCTGGCTCGTGTTGAAGTGGAGGAGACACAGCAGTTCAAAGACCGATTGGCAGACCAATTGCTGCAGATT
ATGCTGGCCAGCGAGAAGCTCAAGAACGAGCGGATGCAGCAGCTCTTTGCTGAGGTCGATCGTAGCTGATAGCACGAAGGACGCTGCGTACGTGATAAAC
GTTGGAAGTATCTACTGTATTACTACCGATGTGGAAGCAGACACGCACTAGAGTAAAAGGCGAAAGACCTCACAAGCTCTTCCTTGGTAGCAAGCGAGGG
CTTCTCCCCCTTTCAGCGTGCTTGGTTCCGTGCTGTTGTATGTCCAGAGGCGGTCACACATGAGCTAGACCCTCTTGGCTTACTCGTCCTCCGTCACGAC
GTCAGCGTCCGCGAACTCGGCCGCCACGGCGGGCTCAGCGACAATGGGAGCCATGCCCGGGCCCCACGAAGGGAGATCGGCAGCAACGCCACCGAGCGAC
GGGAAGGCGTCCTTGTCGCTGGCGTT