Description :
From Genome Similarity Track
Location :
Scaffold_1659:780- 3597
Sequence
2817 bases(100 bases per row)
GTATCAACCTATAAATACATTCGGTCTTATATCTACCGCTTTTCAAGGCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCA
TCTTTGGGACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCATTCGACACCTACGAGCGAGGGCTCATCGC
CCACGTTCAAGGGCTGCAGGCCACTGCGGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCA
TGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAA
GGCGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCTGGGCACGAAGTACTGT
GTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAAGCAGGCATGGTGCGGGAGTCGAAGTCCC
CGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGAC
ACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATACGCTGTATAGCGCGCTGGACCTGGTGGACGAATACTACCAGATCCTGATGCGCGAGAGGGACA
TCCCATTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGT
CACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTG
CATCTCCAGCACCTTCG