Description :
From Genome Similarity Track
Location :
scaffold_1185:780- 3041
Transcript NameFunction/comments
Pl_101113hypothetical protein PHYSODRAFT_315332

Sequence
2261 bases(100 bases per row)
CACTCCATTCACCACCCCAGTCGCCAAATATGACAGGATACTAAACACAGCGCATATCGCTGCAACCTTCTTCGGGGCCGAATTGAGCATGGCAGTGTAG
AAACCTCCATTCAATGGAACCGCACTCATGACCTCTTCAAACACCCATCGCAGGCAGTAGATCACAACTGCAACAAATAATTGTGCCATTGGAGCAAGTT
TTCCAGCTTTGGCGATAGTTTGCCCCGTAGAGAATAAAACGCTGGACATGATGTCATTTCCACCGATAGATGTCGCCGTCCACTCCCCGAGCTTTTCTTC
TTTTTCGTGCAGCTCCAGTTCCTCGCGAATGGCATTAATCTCGTCAGTTCTACCTTGAACATACTGGGCTTCGCCGCCAATATTGGGATGCATCCAGGAG
GGCTCCTTGAACCTTTGGTCTGTAACTTGGATCTGGATAAACCGTTGACGGAGTTGACTGGGGGTCTCAGCCCTCATAAAATTCATTTCGCTCACCCACA
CGGATGCTTCCGCATCTGGCGGTTGACGCACTTCAAGCGATCTATCGGGCGTCAGTAGCTCCACACGCAGGTCTTGATCGTTGGTCTTGGTCATTTCTCT
TCAGCTGTTTGAACAGAGAATTTTCAACTGACAATCGAGGTTCGACTATTTAGAGTGAGCATTGAGGATGCTTAAAAGGTCTACCTAATGGCGTCTTATC
TGAAACGTGCTAGGTAACACCCTCAAGTGTCTGCAGTGATCAACGTTTCACACGGGAAAGCCTACTCTAGAGCAAAGAAACTAAAAATCTTGGCGCGTCA
ACGATACACGAGATCAATGTCCAGTCTCACATTTCATCCGTTTTCATGAAATGCAACTGTTTACCATTAGAAAACTAACGGAGGAGAGTCTTCGTCGACC
TCTTCATCCAGATCTCCTTTAGAGCTAACAGGATACCTTGCAGTACATGTTTTAGTCACAAGCGGCGTCATTTGTAGTCTACTGGGATGTGCGTTGTGGT
CGTCATTCTCCCTTTTCACTAACCCACGAATGCTGACTGTACCTCCTTGTTGTCGCGCTGGAGATGCATTCTGCGCGGCTTCGAGCAGCTGACGACATTC
AGTAGCAACGTGTTAGTAGGTCTTAAACCGAGTGCAAAACATAAAAACCCTAGAGTGGACGTAACAGTGTCTTACCTCATCCGAGATTTTCGATTGCTGT
GTGGTTGTCCGAGTCGTCGAAGTCGATTTCGTCTTGGTGTGTTTGCCCTTCTCTTGCGTCTTTTCTTTCTCTTCACGATACAAATGTGCGCGTAGCTGCT
GTGTCGGGGTAACATGAGCCTTCGGTAGAGTCAAGCGTAAAGTGCCAGAAACCTTCGACCTCTCAGCTTTACCCGCGTCGGAGTGCACAAGCTCCGGAAA
TTTGAGGCGGAGAACCTTGTTCTTTGCTACAATAGAGACATATGAAGGGTGTACGTCAACATCTACCAGCGACGTATCTAGGAATCGAGGTAGATCCACT
TCGAGAATGATGTCGAGAACTTCGTCTATGAGTCGAAACTCCCATTTACCCTCGTTGCATTGCCGAACAGATCCATCTGCCCTCTCTTCCTGTTCTCGAG
CCTTCCGTAATGTCTCCTCATGTTCCGACTCGGTGTTCCTTTCTTTCGGCTGATTTTCGCGTCTTCGAGCTTCTTCTTCCTCCTTTTGCTCCGCCATCTC
CAGATACATCTCACGGCGCGTTTGCGGCGTATACGGCACTTTCTCCGTCGATGTCATCACGGATTTCTTCTTTCCATTCTTTTCTTGCTCCTCCGAAATG
TCGGTGACTTCGCCTCCCACCACTTCTATCACTGTTGCATCTTCTACAATCTGTTGCTCTTGTTCCAGTGCTTTCTTGGCAAGCATTTTCTTAGCTTCTC
TGCGTACGTACTGCTGTCTCTCTCGAAATACCTGTAGAGCCTTAATTCGATCACTACGTTGGATTTCTTTGCCGTCCAGTATCTCCAGCTGAGGCAGCGA
GGCAATAATATATTCTCTAAAGCCCGTTTCCCAGTTAGACTGACACGGATTACCGAGCATATAGAGCTCTCGAAGGTGCTGCAGAGGCTTCAGATGATTG
AGACTCTCTTCCAGTGTATCAAAGTCCACAAAGTTGACGGTAAGATCCAGCTTATTGAGGAACTCACAGCTCTGCAACCCCTCGATCTTGTTGATGTTGT
TCAGAGCCAAATTGAGGTACCGCAGCTCCTTCATATGCGTCAGGTCCTCCATTTTCTCGAT