Description :
From Genome Similarity Track
Location :
Scaffold_2741:780- 2632
Transcript NameFunction/comments
Phyin_T30-4PITG_22387Putative uncharacterized protein

Sequence
1852 bases(100 bases per row)
ACGACAATAGTGCCCTGAATTCTTCTCAGACGTCGCCAGGTAGCACCACTGTTCACGCGACACCAACAGTTGGAATCCACGCTCTTGTCAACCGCGTGCT
CGATCGCGTTGCTGGTCCTGCTGGAGTCGAAGTGTCGCTGACGTCACATTCGTTTCGCCGTGGAGGCGCGCAACACGCGAACGCAAACTCAGAGCTGGCA
GCTCAAAGAGATTCTTTGATGCGCGGAGCTTGGAACTTAAATTAGGACTAAAAAACACAGCGTGTGCGTACGTCTTCAACACCCCTAAAGAAGATCATCA
AGTTGCTAAGGTGCTGAGTGGGATGACGCCAAAGCAAGCCTCTTCTCTCCCGTCCCTGGAATCCTTCGACGCTGCAACACTAGAAAAGGTTAGAGAGGTT
AGCCGGAAGCTTTTCAACTCGAGCCATGATCTGGGTAACAAGACCTTTAACGTCTGCGCTGTTGTGAGAGATGTGCTAACAGCAACCCTCCTCCTCCACT
ACCCGTCGTTAGTGAAGATCAACGCGAAGACACCTGCAATGAAGACAATTCACCTATGTGCGGAAGCCTCTGGAGTGACGACGACCAACCTGCTTGCATG
GTCACAACGGCTCACAGCGTCAAATGAACACGCCAACACCACCGCCGAAGCCATGACTGAAGAAAATGTAAAGGCCAACGCTGCGTTGAATTATCAAACT
GCCTTGATTGAAAGGTTAATTGAGGTCAGCCGTAGCCTTGAAGCTCGAGTTAACTCGCTAGAAGCTGCAATGAACAACACCGAAGGGGAAACTTTAGCAC
GAGATAATCAAGCCAAGCGAGTAAGAGACGAAGATGAAATCGTACCAGTAAAGCGTCGCCGTCGATCCAAGACAATACCGCTTGTTGACACGTGGTTTGC
GTGGTACACGGCTGTTCCGCGTGGATGGCAGAGTACTAATAAGCACAAGAAATCGGATTCCAAGCAGCTCGTGGCCTTCATGAGGCTCTTCATCGAAGAC
GGGTACGCGCTCGACGAGTTATCATCCAGCTACAAAGATACAGTACGTCAGCTCGGAGAGTTAGCGTCAAACAAAGTCACAGTGTTCCTAGGCGAGCAGG
GCGTACCGTCAAAGGGATCCAACGCTGTGCTTAAGATTCTTCGGCAGATGCACCGCGAAGGCAAGCTGAATAGTCTCATCAGTGCCTACCATCAGCGTTT
TACCATCGGCAGAGTTGTAGACCCTACACCAACACAGCACCAAAGCATGCTCAAGCTGCTCCCGTAACACAATCCAATCTCTCTGTGTCCTTGTAGCTGG
TTCTTATATCATGTCAATCATGTAGAGACCTGCAAGGCATTCGAGCATAAATTTTTTACCAATGGGTGGATTTGAATCGTCAAGTCGTTCGTCACGTTGC
AGGCGACGATTCAGCATATCTCGCTTGAGAAACACGCTGTTTACTCCAGGATGGTTATCAAAATGATCTTCCAGTGTTCGCCACAGTAGGATAGGATCAG
CACGTTGAATAACACTTGTAAATCGCATCTGTAGCTCTTGACTAAGTCCCATCGTAAGTTCACGTTGAGCAACACGCAGTCGTTGCTTGAAACAGCCGCG
CTGTCCTTCGTTACGTTGGTCTGCCATCGTTTCGCGCTCCATGATGGGGTCCAAGAGGTGTGCGACGTCGAGAATGGAGCAAATCTCGACGCGCCACGTC
TGGTAGTTGGTATCGGTAAGTCTTGCGTTCAACTGCACGTGTCCGCTCTGGTTCATGCACCGCGTGCATCTGTGGTCTCCAACCATGGGTTCGTCCGTAG
CGGAGTCGGTCCCGGCCTCGGTCTGGACTGGCTGCGCTGCAGCCTCGGACGT