Description :
From Genome Similarity Track
Location :
Scaffold_761:780- 1917
Sequence
1137 bases(100 bases per row)
TGTTACTTTTGTAGCTAACGTATTTCTTACAGCTGCACCAGGCCCTTGTCTCTGTGCCGGTTCCCGCGACACTTGAATTACTGTCAGCTCGCTATTGACT
ACACTAGACTCATCTAGCTGGTTAGTCCTTGGTGACGCTTGACTCACTGTCGATGCACCCTTGACTAAATTAAACACAGCATCATTTACGTTATCCTCTC
TCAAGCGCACATCCTTTCCGGTGTCTTGCGTAGAGCTAGCGACTGTGCTTGTTCGTCAGTCTATCCACTGTTGATGTTTTAACCAACCAGGCATACTTAG
GATGAGGTCATACGGACTATCTATGCCTAGCACTGTGAACTTCTCTTTGCACGAGAAGTCACTGAAACCGAAGGCAAGTTCGACGTGAACTCTCTCTAAT
GTCACAAGCGTACTGTCTGCTAAGCGAACGGTCGCTTCTATACGCTTGCTATCTCGGCAAAGCGCCTCATAAATCGCCGGACTCTTTTTCAGAGCCGCGA
GATTTGCAACGTTCTGTGACGCATCCGAATCTACGAGAAGGGTCATCACCTGGTCCTAGTCGCGCACTCGAGCGCAATAAACCAGCATGTTTGATGACCA
TTTGCCTGGTACCTCGGGGACCATACTACCCATTTGTTTAACAACTCTAAACGTCGGGGTAGTTTCAGTCCGCGTCAGTACGGCATCCCGCCCCCACCGC
GCTACTGCGTTCCTGACCCATGCTTGGTCGATGTGGAATCCGAGCGTCTTGAACGCTGGTTCTTCACACCAACCTTTGGGTTGATAATTTTCATGCCAGG
CGCTTTCGCGCTAACGCCACTTTTGCATATCAGCGAGCCATCATATGGTCGCGCACTTGTAGTTGACAACATCTGCGTTGTCCAACTCCATTGTAGTGGC
GTCAGACCTTTCGTTTGCCGGCTTTTGCTAAGGCGTTACCGAAGCAATTGCTCATCAACTAAAGCAATCTCAATTGCTTCTTTCATTTTGACGGCACCTT
TCTGAAAAGGTCCTGTCGCGCTGGACCATGCCGCAGTCAATTTTGGAACGTGGGTACCTTAATGTGTTTCGGTATCGGACCCGAATCTCCTGCACATAGT
CTTGCAGGGATCGCTGTGCTTTCGCGAGCTAAAGAAG