Description :
From Genome Similarity Track
Location :
Scaffold_858:78- 3182
Sequence
3104 bases(100 bases per row)
CCCGCTGCGAGCACCGCGCATACGTACGAGATGGCTGCTGCAGCCACTGGTCAGAGCCTCAGCTCAACTACTGACCTGATCGCTCCCCACTCTAGTGGGA
GGCGCCCAGCGCCTGGCGACGCTGTCGCACACCATGGTGGCTATTCAACACATGATATGCCCCGGTCGTAAGCGTTAACGACGTCAGGGTAATCTTGCCG
GAGGATAACCTCAAACTCCCATGAGTTCTGTGAGTGTGGGTAACCCCTCCACTTCACCAAGTACTGGGTACGGCCCTGGCGTCTTCGCCGCGACAAAGCG
TTCCACGTGAAAGTGGAGCTCACTAAGCTCATCAAGAAGAACGGGAGGAGGCCTTGCCTCAGCTGAGCTCTCGCGGGGAGAGTCGGCACTTACCGAAACG
GCGTCTGCGTCCATACGACTCCGGCGTCCACGACGCGAGCGTTCGCGTTCACCGCCCATCATCGGTCTTGAAGATATGATCCACCTTATGGATAGGTTAG
AGCCACCACTGCTGACTCACAACCAAGTGTCGGACCTTGAGCGTCCAGTTGCTCGGCTGAACGTTCAGCTTGCCTTGCTCCTTTTTCTCGAGCACTTCGC
TCTGCGACCTGTGGCTCTGCCACATGCTGTTGATCAGCCATCTGTGGGTCCACCACTTGCTGTCGTTCAGCCTCACGTGGCTCTACCACCTGCTGCCCTG
CAGCGTTCTGAAGCCCAGCCACCGTTGGCGCCAACGCCTCCGCGCTCACCTGAGCAGGGTCTTGATATGGCTTAAGCAAGCCAACATACAAGACGGGATG
CGTGCGCATCTTCTTTCGGAAGGCTGAGCGTATACGCTAGGGCTCTTCCTGGCCACGACCTTTGAACGGTCCTAAGAACCGATGTATCAACTTCGTCTTG
AAGACTGCAGACACTGCATGAGTAAGTAGTTTTTTAGCGTTTATTAAAACTTGGTCACCGACCTCTAACCTCTCAACATTGCTTCTGCCCTTGGCATCTA
CATGTTCCTTCTGCGCGTCTTGGCTTTCAGCCATAATATCGCATACTTGACGCATTACGCTCAGTCTTAAGAGACAAATTCATCGACTTGCTTGCGAACC
GCAACAGGGATGGCATCAGCTAGCCGCTCGGCTATCCCTCCCTGAGCCACCGCGTGGCGGCGTCAGTGGGACGCGAGGGTTCTCCAAGCTGTTCACATAG
AACGGAGTGTAGCCTTTCGAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTCGGCGTCTCAGCGCATACGA
TTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCGGTTGGACTGCCAACATCCCTTGGCGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGTG
CGGACTCTGTCCGTTGACACGTCGCGCACGTGCGTACACAGGTGCTAGCCCACTTATACATCTTGGGCCACCAGTACATCGAGCTTACCGAGCGATAGGT
CTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTTTAGATCCTCATCATGAGGATCGACTACACGAGGGCTA
TCCTCAGAGTCGGTGCTGTAGTACAGCAGACCGCCATCGAGCGAGTATCGATGCAGACTCGCGCGCAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAA
GCTCATCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCTTGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGAC
ATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCCTCGGCCTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGCCAAAGAAGGA
AATCCATCTTGCCATTTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTCTGTAGCGACGCATGATCAGTATGGGTCGCAAAAGGCTTAGAGCCTAGCAG
GTGTACCCCTGAAATTTGACTAGAGGCATACTTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGAGACTC
AAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATCC
GGGTCCGGCAGCGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCT
TAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTCGCACTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTT
CTTGGGAACCGGCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCG
CCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTATCCACGTCTGACTTTC
CGTGCTCGGCACGACTATGGACGAATATATCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGGGCCTAAACAGCTGCGTCACAAGACGATTGAACGTTGC
TGGTGCGTTTGACAGCCCCTGGGGCATCACCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACTGCTGTCAGCGGAATGTCGCTCGCTCTCATGAGC
AATTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAGCGTACAGCCTTACCATGTTGTTCTGCAGAACATCTTTGCGAGGAATCGGCGTTTGCCGC
CGGGATAGTGGCGGCATTTAGCTTGTTAAAAGCATGAACAATGCTGCCACTTTGCCGTTCGGCTTTTCTGAACACAGAACGTGGGTTGTCAAGTGGCGGA
GACTATACTTCTCACGCACCCATCCTCTGGCCTCCGTGGTTTCTCAAGTGAAAATTGCTTTCATTGAACGTTATACTGGCTTCTCTCGGCTAAGGGCCAT
TGCC