Description :
From Genome Similarity Track
Location :
Scaffold_34:78- 2799
Sequence
2721 bases(100 bases per row)
GTGTAACCCTGTTACACCATCCCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCACGTCAATCAGGAAATTGACCAATCGTCAATTCTTCACGTTGGGA
GAAAGAAAACTCGAGCTCATTCCGCACTGAGCTCGCCGCAGAAGAAGACCGCCGCCGCAACAGAGGGTGACCTCTCTGTTGCTCAGTACCATGAGCGCCA
GCAGGCAAAGCGCGATGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACCCAGTCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGAC
TACGAAGACGACGACGTGGAGATGGAAGAGGGCGAGGCCTCTTCCAACAAGCGCAAGGAGTCTATCGACGGCGATAGTCTCGACCCGCATGCCGGGTCGA
GACGCCCTCGTGAAGGAGACGATTCGGACGCTTCAAGCTCGAAGCGTTCGCGCGGCGAGAGCGACACTCCGCTCTCCGCTGCTGGGGCTTTAAGCTCCCC
GCGTGAGGTGGCGCCTTCAAGCTCTCCGCGCGCTGCTCAGGCAGCGCGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGCGGGCAACACC
GTGCCTCCAAATGAAATTCCGCTGTACGTATGCAGCGGGGTACACGATGATGCTGTGGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCG
ATTACTATATCGGACTCTTTCACGAGCTCCGATACTTCTCCAGCAAGAAGACTTCTTCTCGCAGTAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTG
AAATGCTTTTGTTGAGAACTTCAACAAGACGCCGGCTGCCTACCGTGAGCGGGTTAAGCATGCCCGTGAGCGCTTCGAGACATTCTCGACGCGCGGGAGG
CTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTGTTCCATGCGCTGTGCCCGAAGGCCAACAGTGCACGTTGTGTCTTCCGGGTGCGGCGCGCTTGA
GCGACCGCGACCTAAACGGGTACACGACGATTCGTGTACCTGCGAGTCTCAAGGATCTCCGTACCAAGTTCTTGGCACGTGAGGAACGCGACGATCGTGG
GGCCTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGTGCGTGGTGAGCTTCGTACGCCCTCACCATTTCCGGAACGTCCTGCA
GCAGGACGTCCCGTGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAACCGGCTGCCGGTTCGTTTTCTGGAAATTATG
GTTCACAATACGCTCAACAATCCAGCGTGTTGAGCCGCGGGCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGCCCCGGGTATGGTCAACCTGGGGT
TGACCTTGGCCCGACGCTCGAGGAGCGGGTCGCTGCTGTGGAACAGCATCAGAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCGGATGC