Description :
From Genome Similarity Track
Location :
Scaffold_1557:78- 2095
Sequence
2017 bases(100 bases per row)
TTGGGTCTCTCGACTCCTTGTCGTCAGGATCTCTCGTGACTCGTCTCGAGTCGGTCGTCGAAGGTCGGCTGACGTACTACTGGCCAAGTAGGAATGGTGT
GTGCGACGAATGGTAAGACCAAAAGTGTCTTAGCTACCTGCTCGTGCCTCCTAGACTCCTGTCCGTTTGATAAGCTTCCTATTCCGCGCCTATTCCACCG
AGCTGCTCCATCTGATCCCGATTCATTGGCTGTAGTGTTCCATGAGCTCTGCGACCACAATTGTCGGCTGACACCAGGCGGGATAGCCACAGCTCGACAC
CAACTGTTCGATTCAGATGGGCATCGCGACATGCCCTCTCACAAGCGAGGCGCCCCCGTGCGGTCGTGGTATCGGTCAATCAATCCCGGGATGTAGCGAA
GATGGCTCAGTGGTTCCCATGTCTCGTCTTCTTGGCCGAGCCATTTAACACGATACTCGATCTTGCCTTTGCGCTTCCGGTGGCCGACAATATCGTCGAC
CAATTCTCCTTCCGACCCGTCGGGGAGCTGTACTTTCATGATCTTCTGGTGTACCCGTTTGTCGCCCGATGGAATGTTGGGTTTGAGCAGACTGGTGTGA
AACACAGGGTGCATCTTTACACCCCGGTTCAGTTGCAGACGGTAATAGTCATGACTGAGTCGCTGCTGTACTTCGAATGGGCCAATCCATCGAGCACCCA
GCTTTCTCTTCGTTGTTCCGGCGTGAAAGGTTGCGAGATTCTCCGTTGAGAGCAGAACCATATCGCCGACATTGAACTCTTGAACGGGCCGTTTGGCGTC
ATAGTACTTCTGCATTCGGTCTTGTGCGATCTGAATCTCGCGACGTGCAACGGCCAAAATATCCGCTTGTCGTTGGACAAATTCTTCGTGATCTGTCAGT
GCCGACATTCCACTTGTGCGTGGTGGTAGAGTCAATTGAACTGGAGTGAGTGGGGCATATCCCAAATCCGCCACGAATGGCGACATCTTGATCGCTTCAT
GGTACCGCGAGTTATATGCGAACTCAGCCAGTCCGAGAAACTGGTCCCAGTCGTCCGAATTGCCGTTCGAAAAGGCTCGTAGGTAGTTCTCGATAGTCTG
GTTGATTCGCTCCGTGATGCCATTCGCTTGATGACGATAAGCGGGCGGCATCTTCTGCTTGGTTCCCAGGAGTTGACACATTTTGGCCCAAAACTGCGAT
CTGAACTTTGTATCACGATCGGACAGCATTTCCAACGGCAATCCGTGCAGCTTGAAGACGTGATCGCGGTACAATCGAGCAGTATCCTCAGCTTTGTCGG
TTTCTGAGCATGCAATAAAATGCGCGCGTCTCGTGAGCTGGTCGACGACGACCATGATCGCGTCGTGGCCCCCTTGCGTCGGGGGCAACTTGACAATGAA
GTCCATCGCAACGTGCGACCAGCGACTTTCCGGGATCGGGTGCGATTTGAGGTGCCCTGGAGGCTTGGTATTGCGGGGTTTTGTACGCTGACATGTTTCG
CAGGTGTTCACATATTGACGAACGGATCGCTGCATGTGTCGCCAGTAGAAGTCCACCTCGACCAGACGCAATGTTCGATCGATGCCGGGGTGGCCGGCTG
ACTCGACGTCGTGGTACTCGAAGATCACGGCTTCTACCAACTCCTTGACTGCTGGGATGACCACTCGTGGTTTGTTGTCACTAGGCGACTGATACATAAG
CACACCATCGTCGACTGAATATCGTTCAGTATTGCGAATCCGCTGAACATCGTGCTCATTGTTGCCGTGTAGTTGTTGCCATGCACTATGCGTCACTGGG
TCGTCATCGTATCGGGCTTTGGCTTCTCGGATCAGCGATGGAATCCCTTGAGCAATGCGAGCGGTGATGTTCTGCACACTAATGATATCCGAGGGCTTCA
CTGTGCTGGTCTGCTCAGTATCCTCGTCGAATGCTGGTTTCAAATCAGGTCGCCGCGAAATTGCATCAGCCACATCATTGCTGGAGCCTGGGATATACTT
GAATGTGATCGGGTATT