Description :
From Genome Similarity Track
Location :
Scaffold_3353:78- 1624
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3353-snap-gene-0.1H.sapiens EEA1, early endosome antigen 1 (EEA1)

Sequence
1546 bases(100 bases per row)
CCACTCTTCAGCTGCAGTTTGCTGCTTTGGTTGAGCCGTCGAGGTTCGCTGTTGATCGTACTCGTTCAAGCTCAGGTCGTCGATGTGGAGTCGCCGATAT
TCCTTCTTGGCACTGCCATTTTCGCCCACAACAGGATCTGTGAACCACGTGTCATCGTCCAAGTTGAAGAGATCATTTGCCTGCTTCCTCTTGTCTTTTC
CACGTTGTTTTGGTCGCGAGGCCTGGTTCTGAGCTTCCGTTTTGCGCTCAACCACCGCGCTCTTCTTCTCAGGCTGAGTGGCGAAGCTTGGACGGTCTTC
TTTCTTCTTGTCGTACTTGGGAGTGAATGTCTTCTTCAGGTTCTCGCGCAGCTTGCCTCGCTTCTTTTCCGAGCTACCAGGCGGTGTTGCGGGCATGTCG
TCGTCTGTAACAACTGCCCAGTCGACGCTCTCTCTCGCATCCGTATCTGTGACGCGATACACGTCGATCGGGAGCGAGTCTTGCCGAGTTGGCGTCGGAG
CTCGTGCGGCTATAATCTGGCGACTTTGCGCATCCTGCCACTCTTCTGCCGCTGTCTGTTGCTGCTGTGGTCGCGGCATCTCCATGCCTCCTTGCGAGCG
ATCTACACTCTCTCTTGCATCCGAGTCTGTCAAGCGGTTCGCGCTCGCCAGCTCGTTGTTGCACGTCGAGCACACGCGGTGTTTCTTGCGGCTGACCTCA
AAGTACCGAAACACGGAGCAGTCCGAGCACATGACGCGACCGCAGTGTCTACAGAAAAATAAATAATTGTAAACAATGAGCAATCAAAAACGATAAACAC
TAAACCTGTACACAAGCGTACCGGCAGTGGTGCTTGCGCTTAAAGAGCGAGAACGAGCTCACGCATGAAAAGCACGCCTTGACCGCGTCGTCGTCCTCCC
AGTCCACGTTGAAGAGCTCTTCGCTTCCTTTTCGTTGCCTCGTCTTCTGCCCTCGCGCGCCTCCACCAGCAGCAGCTCGTGTGCTTAAGCTCTGCGCGCC
TTTCGCCTTCGCAGCCTTGGCTTTCTGCTTAGCGGCTCTTCGACTCGTAGGCTCGCTTGCTCGGCCGCCTGGCGTAGTCCCACCTCCCACACCGCCAGCG
TCGGATCGAGAATACGTCGTGCTCGGGACACTGGACACCGGACTCACAGGGTAGCTGTGCGCGCCGCCGCCATCCACACTGTGGCGACCACTCACAGGCG
CACGAGGCTGATGAGCAGCGTATGTACTAGCATCTACGTGAGGTCGTGGACCTGTTGCTGCTGGTGTCGTTACTGTTCGGCCGTCCGCGCGCTTGTTCAG
CGGGTTGCCATAGAGATCATCAAAGTCGCCGTCGTCGTCCTGTAACAAGAGCCACACACCATATCACGCACATATGCACACACACACACGCAGCAGTCAG
TCGGTAGCAGTCTACGTGGCCACGAAGCGTGCGTCCTCTGCGCCGTCACCTCGTCGAAGAACGGATCGCTCATGCTCCCACGGCTCTTCCGCTTTCTCTT
TGAAGTCGGCGCCCAAAAATGCAGTCAGATCCACATTCCTAACATT