Description :
From Genome Similarity Track
Location :
Scaffold_687:7799- 9433
Sequence
1634 bases(100 bases per row)
TTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATAATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTG
TGGGCCTGCCCTTGCCTGACTCACAATCCACACATTCACCGACATATCGTTGCACGCTCTTGAATAGTCCCCTCCAGTGGAAACATTCCCGGATCCGTTG
GTAGGTCCGACCAATCCCCTGATGTCCACCTTCTAAACTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCTGGCATCACCAATCTGATCAAT
CCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATGCTGTAGGATTTGG
CATCCTCCCGACTCAAGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTTGATGCG
GACTCTCTTCACAAATGTTTCCTCGAGGATCTGTGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGAT
CCAACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTTTTGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCAGCAC
TGGCCAAGCTATCCGCACTGGCATTCCAATCTGGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAG
TGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTGT
AATAAATCCAAACCCAGAAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCA
GTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACCTGTATCGTTCG
GGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGAC
TCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCC
GACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGAGCGCGAG
TATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGA
GCTGCTGAGACTGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGGCGTTCCGGGTCGAAATGACGGAGGATAGGCGTGGTCACGATCCTGTTCCTCA
GTTCCACGAATGCGTGTTGAGCTCGGATCCACCG