Description :
From Genome Similarity Track
Location :
Scaffold_824:7796- 9407
Sequence
1611 bases(100 bases per row)
ATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGCATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGC
GTTACCGCCCGCTGCCCGCGGAAGTCAAAATGTGACATCGATGTCGGCTACGCGAAACCGATCGCTCAGAGGGGTGCGGAAGGGTGGCACCTCAGTTCCG
AGAAAACTATCAGATCTGATTAAGGGCCTGGTGCAAGCCAAGATCATCAGTTTCTCGACATCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGA
ACGGGGTGGATATACGTATGTGCATTGATTACCGGTTAGTTCACGGCCTGACTCGATTGATGGTGTATCCGATGGCTCTAATCAATGAGCTGTTGGAAGA
TTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTATCTGGGTGGTTACTATGACGTATCGAGCTCGCGCAATATCCGCATTCATCACA
CCGTTTGGCCCGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAGCGCCTGATCGATAACGCCCTCTACGGATTCACTC
GAATACCGGAGCCCGAAAAGGGTGGATCCGGGGAAGACCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCGTCTGTGTT
AGGACGCAGATCTTAATATCGACGACATTCTAATCCCGGCGGAATCGTGGGAATAGCTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTG
GAATCTCGCTATCAGTGTGGTAAAGAACTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGAATTGGAAGCGAATCCTAAG
GCCCTGTCTTCGTTAGCCGACTTGTCCTTCCCACAATCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATT
ACGCACTGTTTGCCGCGGTTTTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATCAAAATCTAACAAGCTCTGGCCCG
GGAGATGTCGGATACACGAAGAGATCCAAGTAGTACGACGCCAAAAGAGGACTTAAAACAGGAGCCGGATCCGCCCCGGGACCAAAAGAAAGAGGATCCA
ATTAGAATAGAGACGACGGACCAGAGTTCGGAAGAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCA
CACCCATCCTCCGTCATTTCGATCCGGAGCGTCAACCTACGGTTATAGTTTATGCCAGTGACGGGGCAGTCTCAGCAGCCTTGGTACAAGAACATGAAGA
GATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGCAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTG
GATCTGAATTACAACCTGCTAGTGGGAAGACCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTT
TGGGACAGTGG