Description :
From Genome Similarity Track
Location :
Scaffold_4:77956- 79311
Transcript NameFunction/comments
Phyca_LT1534539778myosin IB heavy chain putative

Sequence
1355 bases(100 bases per row)
gggcgtggacgacctggtgctgctgccatctgtgagcgaaacgtccattttggagaacctcaagatgcgccacgccgctgacgtcatctactcgtacatt
ggtcacgtcttggtggtcgtaaacccgtataaatggcttgatatctacggcgaagacagcatgcgtgcttatatgcacaaggcacgtattgacgtagccc
cacatgtatttgcgacagctgaggagacgtatcggacgatgctcagtgaagaggacaatcagtgtgttattatcagcggagagagtggcgccggcaagac
tgaggcgtcgaaacagatccagaactacattgcaggtgtcagtggcagtggtgcaggcgttgacaaggtgaaacgcacgtttttggagagcaatccgctg
ctggaagcatttggtaatgccaaaacgcttcgcaacaacaattccagtcgatttggtaagtatttcgagctgctatttgactcagcgggacgaccacaag
gtggtaaagtgacgaactacttactggagaagtcacgcgtcgttaaacctggcaagggagagcgcaacttccacatcttctatcaagtattggctggact
gcctgctgctgccaaacagaagctgtacttggatcgaggaggacctgagagctatcactacttaaaggctagtggatgctacgatgtggatgatgtgaac
gacgctcaggagttcgaggagactatggcggccatgcaacacgtgggaatcaagcgcaaacagatcgagcttgtgattcagactctggctgctgtgctgc
atattggcaatgttcgtttccaacccgaggcagtgggggacgcagagggttcttcagtccatgaccgtgaaagcttacagatcgcgtgtgagctgctggg
gctggatgctgcgcgcctggagcacgcattgtgctacaaactgctacagacaatggcccctgggggcaagattgagtcgtatgaggtgcctcaaaacaca
agccaagccaaggcgcaacgagactccatcgcaaaggcggtgtatgaccgactatttgacttcttggtggagcgcgtgaaccatgctctggatattgaaa
agaaggcagagaagcatggagagatcctggagattgacgatatgaccacgattggcatcttagatatctacgggtttgaaatcttcgacaagaacggatt
tgaacagttctgcatcaactacgtgaacgagaagctgcagcagattttcattgagcttacgctgaagagcgagcaagaagagtatgcgcgcgaagggatt
gagtgggctccaattccgttcttcaataataaggtcgtgtgtgatttgattgaag