Description :
From Genome Similarity Track
Location :
contig_2:779453- 780511
Transcript NameFunction/comments
g754.t1hypothetical protein
g755.t1hypothetical protein

Sequence
1058 bases(100 bases per row)
ACGAGGCGTAGCAGCAAAGAGGTCAGTTTCGCGCTTGCAGAGCCATATGCCCCACTCCAGACCGGCGCTGGAGACGGGGGAAGGCGCAAAATACGCAGCA
GAGGCAGCGGGTGCGTACCGAGGACACGGCGTCCGTCTTGGGGGCGTCTTCAGTGCTCATCGTGCTCACAAGCTTGCTGCTGCTGCTTGGCTCCAACGCG
TGGCCTGTTCGGGAATGAGGCGAGTCGACGACTTTTGTTCGAGAACGATGACGTGTCACGAAACCTTTTTGCAATTAATTGCAAATTATATTCTGTCCAA
CACCGTAAATCGAATTTCAATATTATTGGGGAGCCATTCCACATTGTACTTCGACCAAACCTTCCGCCTCCGCCCAGATGAGCGTCTCCGGCATCGTGCG
CCCGCGCTTCCTTTACTCGGGGGCGGGATCCACGCTGCAGTTCCCGCTGGACCTGACATCCACGCCCGCGTCTGAGCTTTCTGTCGATGTCTCAGCGCTC
GAGGGCCGCCTGCAGGACGCGTATTTCGTGGCGCCGGCCTCGCACATCGGCCGCATCGTGACCGGCGTCGTGTTCGTGGCCGAACAAAGCCGCGTGAGCC
GCGCGTTTGCCGGTGCCACTGAGCGCTTCGGACTCACGACCATCTCGTTCGCGGACAAGCTGGCGGAGCAGGGTTACAAGGTGCTGGTGTTGGATTTGTT
TCAAGAGGGGAAGACAAACGACGGCACCACGCAAGAGCACATGGCCATTGTGCAGCAAGCGGCACTGTATCTCAAGCTGAAGCACGACATTCAACGCGTG
GGACTCTGCGGGGTGGGCGCGGGGGCCGATCTTGCCATTAAGGTGGCCGTGGAGCGCTCGGCGCCGCTGGGCTGCGTCGTCGCCATGTGTCCGAAGGGAC
TCGTGGCCTGGAAACCTATTGGAGAACAGACAGAAGAGACGCCGATCATCCCGTTGCTGCTGCAGCTGGGGGATAAGTCGCCCTACGCTGGATCTGAAGC
AGTACGAGGAGGTTTTAAAAATCTTTTTGTGGTGTAACGAATGTTCGGCTAATGGGTG