Description :
From Genome Similarity Track
Location :
Scaffold_6:779228- 792788
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002793Similar to Akap5: A-kinase anchor protein 5 (Rattus norvegicus)
Pytul_DAOMBR144PYU1_G002792Similar to XBP1: X-box-binding protein 1 (Bos taurus)
Pytul_DAOMBR144PYU1_G002791Similar to rab3gap1: Rab3 GTPase-activating protein catalytic subunit (Xenopus laevis)

Sequence
13560 bases(100 bases per row)
AGCGGCGATATCATTAACAGCTTCAGCATCCGACACAACCACATCGACAGTCTCCACAGTCTCAGCTTCAGCTGCAGTTGCTTCGACAATGCTTTCGCTA
GGTTCCACGGCCACCGTAGACACTGATCCAGCAACCATTTCGACAGCTTCAATGTCCGACACCGCCACCTCAACAGACTCCACAGTCACTTCGCAGGCAC
TTTCACTGGTTTCCACAACCACCGCAGATACCGATTCAGTTGTGGCGACTTCGTTGACCGTCTTAGCAGCAATCCCAACTTCAGTCACAGTCGCTTCGCT
GGTGCTTTCGCTCACCTCCTTGGTTACCGCAGGTACGGATTCAGTAGTATCCGCCTTGTCAGCCGTCGCAGCAGTCTCAGCTTCATCGGGCACTAGCCCA
TCCGTTGTGAACACCTCAGAGGTCTTCACGGTCTCAACTTCAGCGACGGTCTCGTCGTTGATGCTTCCGCTAGATTGCACGATCACCGCAGCCACAGACT
CAGTGGCAATCGCCTCTTCGACCGTCAAAGTCGTCTCATCTTCAGACACAGTCGCGCCATTAATGCCTTCGCTCGTATTCATGGCCACAGCAGACACTGA
TTCAGTAGTGGCAATGGCCTCTTCAACAACCTCTACAGTCTCAGCTTCAGCGACAATAATCTCCTCGTTGGTGCTTTCGCTCGTCTCCACGGACACACAT
TCAGCCACAGCAGCCACATCGGGTACCTCAGCGGTCTCCAGTGTTTCACCTTCAGACACAGTCGCGTTGGTAGTGTCTTCACTGAATTCCACGGGCACCG
CAGGTACGGGTCCAGAGGCTTCGACATTTTTAGCCAACTCCGTCGTCTCAGCATCAGTGGCGTTTTCAGCCACCTTGACGAGCTCCACAGTTTCAAGTTC
AGTCGTACTCGCTTCGCTGGTGAGTTTGCTGGCTTTGACCGCCATTACGGAAACAGGGTCAGTTGTTAAAGCTTCGACTTCTACTATAGCTGCATCGACG
CTGTTCACAGTGTCAATCTCAGTCACAGACGACTCAATGGCGCTTTCATTGCCCTCTACGGTGACCGTAGAAACGGATTCAGTCGCAGCGGCAGCCTCTA
CGACCGTCTCAGCGACCACCGCAGCTACCTCGACGGTCTTTACAGTCTCAACCTCGGATGCAATTTTTTCGCTAGAGCTTTCGCTCGCTTCCACGGACAC
CAATTCATTCGCAACAACATCTTCGACAGTCTGTTTAGTATCAGCTTCAGCAGCAGTTGTTTCGCTGGTTTCTTCTTTGACCAGTTCAGACACGGACTCA
ATTGCAGCAACTTCTTCGACGGTCTCCGCACTCATAGATTCAGTCATAGTCGCTTCGCTGATGCTTTCAATGACGTCGACTGCCAACACAAACACTGATG
CAGATGTAGTGTTCTCAATGGCCTCTGCACTCTCACCTTCAGTCAGAGTTACTTCAGCAGTACTGTTGCTCGTTTCCACACTAACGGTCTCGGTCACGGT
CTCCGTGCTTTCGGTAATCACGACTTCTGACGCAGTGGCTTCACTCGTCGTGCTCTCGCTGGTCTCCATGACTGTTGTTCCATTCGCAGAAGCTACTTCA
GAGACTTCAATCCCAGTGTTTGCATCCGCCACTTTTTGAGTTTCAGTCACGACTACTTCTGCCGCCTCCTTATCTTTCCATGCAGTGGCTGCGCTCGCAT
ATTCAACAGCCGCATTTCCTTCCGATGCGACCACTTCTTCTCTCACCTCAGCGACGGAATTCGTGCGGCCGTTCGCCTTCGTGACAGCATCCGATCGCTC
GCGATGCTCATCAGCAAGAGCGTCTTGCGCTGCCGTCGCGCTTGCCACTTGGACTGTTGTCGCGTCGAAAACGCGCGCCGTGCGCGTCTCACGCACTGTT
GTAGTGCCGACGTCTGCCTGTTTCGTTGCAGTCTCTGACGTCATCACCATCGCACTTGAAGACTCGTCTTCACCCTCGGTGCCCGCTGCGTCAACAGCGT
TATTATCAGCCGCAGTCGCCGCACTTTGCGCGGCCTTTTTGCGTCCAAACGGCGTCGAGAACCGCGACATGAGCGATTTCACTTGCGCGGGCGCCGCGTT
CATCAGCTTCTTGCCGGCCGTCGCTGCCGCAGCGGCCGCTTTCGTGGGCGTCATGGCCGCAGCGCGGTCGTGCGGTTGTCGTGCGTCGCCTTCGTTCGCG
TCGTCATCATCCAACTCAATGGACGGATACGACGCCAGCGGATCGTCCGCTTTCATTGTCGCTTGTAGTGATTCAAGTGTTTCTTGCGCACTGACTACGT
CAGCAGCCGCATCGCTCTCCGCGCTGTCGTTGTTGTCGCGTTGACGCTCGCCCTTGACACCACCACCGTCAGCCATCTCGAAGCTGCTGCTATCCTCATC
GTTGTTGTTGCTCTCGTGCGTCTCTATCGAGCGCTCGTGAGCCACCGCGACGCTCTGCTTGCCGTTCTCTGCCGCCTGCTTGACTTGCGGCTTCTGTTTG
GCATGGTGCACCGCCTGCCGCTGCTTCTTCTTCGCCATTGCTGGTTCTCTGTGTGCGCGTGGCAATTAACCTGCGTTTTCTACTACGCGCCCACACGCCA
CCTTTTGCGAGCACACGAGCGTCTCTCTCTACTGCGTGAGTGTGTGGATCTGCTGGTAAATGTGCCAATGCGCGTCCGCGTGTCTTGCGTGATTTGCTTG
TGTTGCGCAGGAAGGGAGCAGCAAAGCCGCAACCTGAAGGTGGTTGCTAAATGAGGGGAAAACCAGTTACGCCAGATAGCTGTAGTATCACTTAAATCAT
TATCTGTGAAAATGAACAGAAGGTTTGGCAAGACTGATGCACTGATAGGAGGTGGGATGGCAGTAGGATGCAATATCTGACTCAAGCCAAGCGATTTCTG
TGCGAGTTACATAGAAAATTGCTAATTGTCACTTGTCAACAGGTTCACAACTGTATTTATTTGCATATGAACAACTAAAAACAACTTTACACTCACGCTT
CCTCTCTCACACGCTCTGGCCAATGGTGCTGCTGGTGCTGTTGCTGTTAGACGCAGAACTGAAATCACCCTCTCGACACCAGCATGATGAACACTGCAAT
AAGGATGCAGACGATCAGGATGATCACATGAATCGGCAGACGTCCGCCTTGACCAAGGAATTCCAGAGCCACTTTTTCTTCCGCTGCAGCTCTCGCAGCC
GGTGCCGTCACAGTCTTGGAAGCGACCACCTTCGATGCAGAAGTCTCAATAACTTCGGCGTGAGCATGCGTATGCTCTTCAGTCACAACTTCTTTCACAG
TGTGATCGCTGCTCGTCGCGATTAGAGTACTAGCAGCGTCTTGGGAACTGCTTTCGCTGACAAACTCGCCTCGTTTTTCACCTTCCTGGCAGGTAGCCGC
AGCTGACGAAGTCTCCAATTCAGCTTCGTTTGAACTCTTTTTGGCTTCAACGTCAACTACACTCGTTTGAGTAATCACAGTTCCACGCGTAGTTTCTTCA
ACCACGTTTTCTGCCGTTGCAGAGAGAGCAGCAGCATCATTGGCGTCACATTCAACAACCTCCTCAATCGTGACGGTTTCAATAGCCATTTCAACTGGTT
CGTTCACGCTACCGGACGCAACAGTCATCCCTTCCACAGTCTTCACCTCCGCCACTTCCGCACTAGACTCACTTGACGCAGTTGCTACAATTGATTCTTC
GACACAAACCACCGATGTAACATCTTCTGTCACGTCATTTCCCACTGTGTTCGTAGCAGCAATACCTTCAGTAGATTCACGTTGCGCCTCTTTTTTCTGC
TTTTGTTCGGCATTTTTCATGTCCTGCTTTTGCTGCTCAGTCAACGCATTGTACTTCTCTCGCTCGGCAGCGACGCGGATGCTTCGTTCTTCTTCGGTGA
AGAAACTGCGCACAGTGCGATACTGGAGGTCGTCCAAAGATTGCTCTTTCTTTCCTTCAAAGCGGCTTGCAATGTTTTTTACTGGAGTTCCCTTATCCAC
GGTCACTTGGTTTGCCGCCCCGCTAAGTCGCCGATTAGAGTGCTCGCCATCGCGTAGCTTTTCATCGCCAACTTCATCGCGGTCAGCATGACCCAGCTTC
AATTCTTGTTTCTGCTGCTCAGTCAACGCGTTGTATTTCTCTCGCTCAGCAGCGACGCGGATGCTTCGTTCTTCTTCGGTGAAGAAACTGCGCACAGTGC
GATACTGGAGATCGTCCAAAGATTGCTCTTTTTTCGCTGCAACTTCGAAGCGGCTTGCAATATTTTTTACTGGCGTTTCTTTATCCACGGCTAACTGTTT
CATCGCCCCGCTAAGTCGGCGATGGACGAGCTCGCCATCATGTGGCTTTTCGTCACTCACGTCACGATTTTCATCGCCCTCACCATTTGCCAGGCTCGAT
TCGTGCTTCTGCTGCTCAGCCAGCGCATTGTACCTCTCTCGTTCCGCAGCAACACGGATACTGCGCTGCTCCTCGGTGAAAAAGCTGCGCACAGTGCGGA
ATTTAAGATCGTCTAAAGATTGCTCTTTCTTCGCTGCGAGTTCGAAACGACTTGCAATGTTCTTGATGCGTTGCTTAGTCTTGTTTTCTGGGGTCGTAAT
ACCAGAGCTTTTATTCTCGACGGACACGCCCTCTGTGACAGCTTCCGATACCACATGTTCCGCCTTTTCACTTGTAGAATATCTACTGCGATCACCGTGA
ACAGTAGCATCCACCGATTCAGAGACAACATCATGCGACTGCTCGCTTTGAATCACCGTCTTGGTAGCATTTGCTTCTTGCTGTTGCTGTTGAGTTAGTG
CATTGTATTTCTCTCGCTCTGCACCAACGCGAACGCTGCGCTCTTCTTCGGTGAAAAAACTGCGTACCGTGCGGAACTTGAGATCGTCTAAGGACTGCTC
TTTCTTTGCTTCAAAACGGCTCGCAATGTTCTTGATGCGTTGTGTTTTGGCGTCCTCAGACTGTTGCACGCTACCATTGACTTCGGTTGAAGCGTTTGTC
GCTCGCCCCTCGCTAACAGCAAGCGGACTTTTTGGAGCGAGCTTCAATTCCTGTGCAGCATTTGCTTCTTGCTTCTGCTGTTCTGTTAATGCGTCGTATT
TCTCCTTTTCGGCGCTGACATGGATGCTGCGTTGTTTCTCAGTGAAGAAGCTTCGTACGGTCCGGAAAGGAAGGTTGTCAAGGGTTTCTTCTTTCTTGGC
CTGGAAGCGATTAATGAAATTTTTTACATCAAACTCTTCCTCTTGGTCATCTTCGTTTACTCCAACCTTGGAGATAGCTCTTGCATCAACAGGTGCATCC
ACAGCCGATTCAGCAAGCACGACATCAAAAATGTCCTCCTTCTCACCCGCGGAAAAAGCACCTCTCACAGCAACACCATCAGTACTTCAATAGTCACAAC
TTCGGTCACGTCTCGCCGCTCGTTTCCACACTCACGGTCTCCGTCTCGATCACACTCACCTCGCTCGTGCTCGCGCTTTCTGCAATCACAACCTCAGACG
CAGACGTCGCGGCGCTCGAGCTTTCGATGGTGATCTCGCTGCTGGCGCTTTCGACGGCGCCTTCGCTGCTCGACGCGGCGGCTGACACCTCCACGGTGGA
TTCAGTCGCAGCGACGCTGGTCTCTTCGACCGCTCCGACGTCCGACACAGTCACCTCGACGGTTTCCACAGTCACAACTTCGGTCACCGTCTCGCCGCTC
GTTTCCACACTCACGGTCTCCGTCTCGATCACACTCACCTCGCTCGTGCTCGCGCTTTCTGCAATCACAACCTCAGACGCAGACGTCGCGGCGCTCGAGC
TTTCGATGGTGATCTCGCTGCTGGCGCTTTCGACGGCGCCTTCGCTGCTCGACGCGGCGGCTGACACCTCCACGGTGGATTCAGTCGCAGCGACGCTGGT
CTCTTCGACCGCTCCGACGTCCGACACAGTCACCTCGACGGTTTCCACAGTCACAACTTCGGTCACCGTCTCGCCGCTCGTTTCCACACTCACGGTCTCC
GTCTCGATCACACTCACCTCGCTCGTGCTCGCGCTTTCTGCAATCACAACCTCAGACGCAGACGTCGCGGCGCTCGAGCTTTCGATGGTGATCTCGCTGC
TGGCGCTTTCGACGGCGCCTTCGCTGCTCGACGCGGCGGCTGACACCTCCACGGTGGATTCAGTCGCAGCGACGCTGGTCTCTTCGACCGCTCCGACGTC
CGACACAGTCACCTCGACGGTTTCCACAGTCACAACTTCGGTCACCGTCTCGCCGCTCGTTTCCACACTCACGGTCTCCGTCTCGATCACACTCACCTCG
CTCGTGCTCGCGCTTTCTGCAATCACAACCTCAGACGCAGACGTCGCGGCGCTCGAGCTTGTGTCGGTGGTAACACTCTGGATTGTATGTGCTGTTGACG
TTGGTGCAATGGAAGTGTCTACTGTTTCTGTAGTAGTGGTGACAGTAGTTGAAGTTGTCTTCTTTTTCCCAAACGGCGTCGAAAATCGTGACATGAACGA
TTTGACCTGCGCGGAACCAGCATTCAATGCTAATTTCTTTCCGGCGGTTGCAGCGGTCTTTGTCGGTGTCTCCGCTTTCTTCGCGTCCGCAGACGTTGTG
GAAGTCTCCACGGCTACAGTCTCATGCGTCACTTGGTTGTCTTCCGTCACTGTGGTGGTCGCTGACGCTTCATCCTTCGCGATGGTACCATCATAACTAT
CGTCCTCGGCGCCATTGTTGTTGCCACTACTTTTCACAGCTGTCACCTCCTCTTTGACAAGCGTGGTGGAGGATGAAGAGTCCGCAGCGACTTGCTGCAC
CTTTGCATTCTGCTCACCGTTGCTGCTCTGCGTTCCCGCGAGGCCTCCCTGCGTCATCTTGTCCCTCTCGCTCGTTGTGGTTGTTGATGGCAGCACGCAG
TTTGAGGAGTGAGGCGACTGATTTATTTCAAATGAGACGCGATGGCGAATGGGGACCGCGGGCCTTTCTTCCTCTTGCGGAATGCGCTTCTTTGCCTTCG
CTTCTTTTTCCGCAATGAGAACGATGCGGGAGGGAGTGCACACAAGATCGGGTTGCTTGATGAGGGGGGTAAACAGAGAGCAGGCGGGAAATACGGAATT
TTTTGCACTTATATCAGTCCAATTGACTGTGACAGATACTAATCGTATAAGAAACGGACAATGCGTATACTGTATTAGAAAATAGAGAGTACTACAATTG
GAGCGGAAAAACACAGGGAGAGATATACGATCCGTTTCGAAGCGCATACACTTGACTCAGGTTTACCAAACGTTCACTAAAAGAAGTACACCACCATGCA
CTTCATGGGTTCTTTTTTTCAAACATGAAAACACTCTCATCTTACAGCAATAATACTTCACACAATTTGCCTTCGACTACACGTGAACTCTCCATGCAAA
TGGAGTCGTCACGGGGGTTTATTCCTGGCGTAGATAACACTGCAATTCGTAACCCACAGCGCGTGCGGATCGGTTCACGAGCCCACGTGGCACTTGACTG
CCACAGAGAGCGGGTAGACGTCGTCCGATCGCTCGCAAGCTCTTGACATAATCGGCCTCGAAGGTGACGTGGCACCACGAGAGGAAGTGAAAATGCGCGT
CTGTGTGCATGCGCTGGTCACCAACAGCGGCGACTGTCTTGGTGGCAGTAAATATTGTACAAGCGCCACACTTCGGTGTTGCTCATCCAACGTGCTTTAT
GCATCAAAGTCGAGCTCAATGTCGGCAAAGCCGCCGTCTTCGGCCATGTAGTCATACACGAAGAGACTCTCCCAGCGCAACACGACGGACGAGAACGCCT
TGGCGAGTTCGCTCATGAGAACCTCGGGTTCCTTGCCCATGCTATCGTAGCCGCCGCAGCCCTGTACGAGACAGCCTTCGACGACCGAGCCGTCGTCCAT
GGTCTTGGTGATGTCTTCGAACACGTACCCATTGCACTCCTCATGATGGCCGTAGTTCGTCGACTCTGGCAGCCCGACCGAGCGGTTCGCAAAGAACCAG
CGGTTGCCAGGGTACTCGTCGTCGTGGGACACGAATTGCACGGTCACGGAGCCCAGCTGCGGCTTCCCCGGGAGCGCCTTCACAGTCTCGACAATCTTCA
TATTGTCCGTAAACACCTTCAGGATCTTCTTTTCCTGCACTTCGGGGAACGTCTCAATGTACTTGGCCGGCTCAATGCGGTGCATCCGCTGTGCAATGTC
CAAGGCGCGCACACCGGCGAAGAACTTGCACGTCTTGGCGTAATACCGCGTGCCTTCGAGCCAAAAGTGGAATTTCCAGTCAAATGCCGTTTGTGAGATG
TCCGGGTGCACCGGCGGGATCAGGATCTTGGACAAGATCTGCTTGGTCTCCTCAACGCGTCGCCAGATGCGGTCAACATCATCGTACTCCTGCCACAGCA
ACTGGTGCTTGGGGGGCTCTGGACTGGTGGCAGTGCCCTTAATATAAACACCTTGATGTTGTTGTGGCTGTGTCTGTGAATGCGAGAACAGCACGACTTC
CTCGGACTTGATGAGTACGTCAAACACGGGCTGTTCCACCGCCGCGGGGCTGTGCGTGGACGTCACGGCGAGCCGCCCGTTGTTGTCGACTCCTTCGTTG
TTGCTGTCCATCATATTGCCACCACTGTGGAGCTGCTGCCGCAGCGCGTCGTTCTCCTTCGTGAGCGCGTCCACATGCTGACGCTGTTGCCGCAGTTCCC
ATTCGTACGATTTGATCGTATGAGAAATGAACTCTTCGAGCTGGAACACTTTCTTCCGTAGCTCTTCGGTCTCTTTCTGTTACAACCAAACGCACATACA
GAACACCAATTCAAGGGGGGTGTCAGCATATCCATTCACTGAGATCATTCATTTCTTCATATTTCCACATATTCACTTACGCGCTGTCGATCGCGACACC
GTCGGGAGGCCGCGCGCACTTGTTCGCGTCGTCGCTGCGCCTTGCGCTGCAGGATCGCGTCGGGACTCATGGTATCACCAGCCGCTGTCGGTGCGTTCAC
CGTGGCGTCATTGGTCTTCAGTTTGCTCTGCTTGTACCCTGCGGTAGGGTGGTCCCGGAGCTGTTCGTCATCGGAGCGTGAGCTTGCGTCTGTGATTGGC
GACGACACGACGCTCAGCATGCGCTTCTTGGTCTCCATGAGTTGGTGGCACAGCGGCGACATCATCGACATGTCCATGTCCGCCATCGTCGCGCTGCCGC
TACTGGCTCCCGCCATGGTCGCGCTAAGAGCGTCGTCGCGCGCCATGCGCTTTGGATACAGTGATGTGGACGAGCCCGCGGCGCTGATCGCGCGCAGAGG
AATACTGAAATGGAGCTGAGCCGACGACAACGCGGCGACAGCGGGTACCATAGGACTGGAGCCCGCCATGCGCATCGAAGGGGAAGCGGTCGATACGACG
ACGGCGAGGGGGCTGGTGGGCATCCCTCCTACGGTCTGTACCGTAGGATTCGAATTGAACCGCGGCGGCATGGGCGTTTGCGTGATGGAGACCGTAATGG
GAAGCCGCGTGTTCCATTATGAGCACAGAAGCCATGGGTGCTCGCTCTCGAGTCTCGCTAATCAAGTGGCTCAGCAGCAACAGAAGAGAAAGAAAAGAGA
GAGGGGAGGCGGACGCATATACTCTGGTTTCTATTCGCTTCTTGTTCATATACCCTTTTAAAAATGTTTGCTTCAATATAGCAGCAAATACACGACACAG
ATACAATAATACTGGACAAATAATTCTCAGCATTGATGATGAGTCCGCCGGTGACGCAATACCGAGGGTCAACTGGAACAAAAGAGCTCCTCCCCGCTGT
TTCCGCTCGCTTCCCAGCGTCTTTCCCTCCCTGTTTCGTGAAAGAGGCATCGCCGCACACGAGCGTTCCAGCTGGTGGCCACAAATCGAACCGACCGCGC
TTCATGCCCCGGCTCTGCACGGCCTGTCAACACGCCCACGAAGTGAGGGAGTAACGGTTGACTTTAGCAGACAGATGGCACTCTTCGAGACAAACAGTGA
ACTCACATCGGTTTATAAAGGGAATTCAAACAAGTAAAACCGAAACTAATAAATCACTTCCTTTAGTGTATTATGTGTGTTAGCTGCAATGGAAAAGAGG
GTCTGAGGGAAGTTTAGAAAAAAAGTTGCACAGAAACAAGCCATGTAATCAAAACAAAGCGGTATAAAAGGATCAATGCGTTTTTACAGGATATCAAAAT
TACAACTAGGGAAAGATAGACACCCTACTCAGCAAATAGTTCTAGGAGGATATAATGTAGTCATACGTTTCGAAAGGTGATACAAAAAATTGATAGCTCC
TCGAATACAACAACAGTTTGACAATACGGGGTAGACACTTTTATCAACCAAATATATAGGCTACAATCGTTCTATTCAAAAGAAATTGCTTTCTATTTTC
AAAGAAATACAGTACGTAACGGCTCGTCACATTTTGTGCCGCAATCACTCAAATGCCGGACCTTCACTCTCTGCTCGATTATGTAATGCTTGTAAGGTGA
TGAGTGCGCTGCGCTACGCACACCCTGTCACCACCGCCACTTACTTTGGCCTGTTTCGCATCAGAGCAGTTTGCAGCAAGACGCTGATGACTCCAGTCGC
TACTGCCTCGCGCGCTTGTGGCGCACACGCACGCCTTCTGATTGTGACTGAACGACTTGACCTCCGCATGGCAAAGTCAGATGGTCTCTCGCCCTGTCAC
AAGAGCACACTCCTCTCCTCGCCCTTTTTCGTGTCGCTCTTGTCCAGCGTTGCTCGGTCTCGTCGACCACAGAATACATTCTTTCAGTGTGTTTGCGGGT
TTTGTCGTTCGCGCCCGTCCTCAGTTTGACGCCGCAATTTGCCTGAGATCGTTGAGATCATTTCCGATCGGAAGAAAAAGGGCAGTCAAAGAATAAGGCT
GCTGTCGTCAGTCAGATGAGTATGACGAGAAGCGAGGGAAGTAAAAAAGCTGAGCTGATCCTGGCTCCTCCGCTGAAAATTGTGGCCGGCAAGCTCTTGA
GACCCAAGACATTCAAGTTGAGTGGAGTTTTCAGCGAAAGGACAACAAATACTACACTGAAGTGCCTCGGTGGACCACGTACTTTGTTCTATGTTGGGCA
CATCGACTTGATGCAACTCACTTTCTTCTTCTCACAAACCAAGCACCCGAGCTTTAAATTTTGCTTGCTCTTCGCCTGCATCTTCTGGCGAACACACTTG
CTTTGTGTTTGCTCCTTCTCCCCTCGATCCATTGACGCAGAGGGTGGATCCTTTTACACGACCCCAGAAGAGCTTCGCAAGCTGGACATGAAGAGCCTGT
CGTGCCAAGGGCATGTGTGCGCCAAAATGCACAAGGTGCTTGGCTCGTAGATGCTTCCAGCGTGGTTGACTGCCGCCCAGAGACGAGACTGCTTTTCACT
GAAAAATGCCTTGGACGTTGAAGTTTGCGAGTGCATGAGGCTCTCTTGTTGCAGCTTTTTATGCGAACCTCATGCGCTTCAATGTCTTACGCGACGGGCC
GGCAGAATAAAAAGAAGCCGCCGGAGGATCCCGTTGCATCCGCTTTGGTCGGACACCAACATGGAACGAAATTTCAGCGCAATAATCAATCACTGCCTTG
AAGCCGCACGCAATGACGATGCGGCCTTTCTCACACAGCAAAAGAAAGGGCGGTACGGTATTGACAGTGTCTTGAAAGGTTACATGTATTTGAAAGCTAT
ACGAAGAGATTGCAGGTATACACTCTGGTCTGTTTGATATAATAAGTATATTATTATATCATGCACTAAAAACTGTCAATAACCACTGTCTTCAACTTTT
GCTGATATCGGACTGTCTGTACCAATGCAATTGCGCAAACTTGCCTCACCACCACCCAACAACATTGCGTTCCAGCATGAGCTCATCGAGTACTGTACTC
TCTCTCCTTCTCCATTCCAGCAGAGCTCTTCAACTTTGGATCTTCCCATCGCTGCGTCGATCGGCTTGTCCCCATCGAATCCCACGGCTTCCTCGTTCTG
CTTGCTGAAAAATGTTGCTCCCCATCTTCACCGCGGTAAACTGAATTTCTGCACACGCACAACCCATCGCCTTCGCAGGATACGGCACTTTTTCTTGATC
GAAGGATACTATTTCACGCAGATCTGCAGCAAACCTATCAAAATTCCGACTCGGCCAGTACCAACGCGAACCGCACCGTATTCCGCTTGAACGCTGCATA
CATGCGGTTCACCACGAGCGGACTCTCCTCGATGCTGCTGCTGCTTTCCACAGCTCGCGGCGAGGGCGACTGATCCACAACTGGGTCGTCGTCCAGGTAA
TACTCTCTTAGGAACGGACGAGGACTAATACAGCGCAGCACATATTCGCGCTGCACCGGGCCGGTCAACACGGGATTCAGCAGCACAAGTGTTGTGACCC
GTTCACGAAGAGCGTCCACTTGAAGCAACTCGGAGATACTGCGACCACCTGGCGCCACGGCGGTGCTCGCATGCCGTTTAGTGTTTCCACTAGCATAATG
GTCGGTTGCAGTCTGCAGCAGTAATAAGTTGATCAATTCGAGACTCGCGGAGGTTGTCGCCGCGTCGTGTAACTTGCTCTCATCCTCAAAAGAGGTAAAA
GGCAAAAGGTATTCGAGCAGCGCGAGTGCGTTCGAGAGCAGGCTCTCAACGTGCTCAAGTTCGAGCACGAGCTTCCAGCATGCATCTAATGCCATCTCGA
ATGCGACTTGCAATTGTCCCTTGGCCTTCTCATGCTCCTCGCGTTGGTCTTTTCCGGCAGGGAATGCAACTTGGGACTCGGCTAAAGCGTCGTCGAGCAA
CGCAATCGCGCGATTGCAACGGTCCACGAGGTCTCGCATCGCCGCATCAAACACTGGGAGCTCCTTGCTCGGGAACGGTAGCGCGGTCGTCAGCGTGTAG
CATGCGCTCGCGATCACACCCGCAAGCATCTGATGGAACAGTTCGTGGGGCGAGATCGTCTCTAGGTAATGGTAAATCTTCTCCGACTCGTGGAGCGGAT
CAAAGAGGCATTTCTGGCGACTCGCAGGCACCGGTGCCGAGGTTTCCCACATTTGCTGCCACAAATGCTTTTGCTGTGTCTTCGAGCCAAAGCGCATACG
CTCCGAGAGCATGCCCTGCTTCTCAAACCACCATACGTTCCTGCCTTCTTCGGGTAAGAATTCCTGCTCACTCTGCAACGGATCCATTGAAATCCAGTCC
TTGGGCGAGTACCATCGGATGAAATCCGCGAGACAGCAGCCTGGATTCGCCGCTTTGAACGCCTGCATATCCGACACNNNNNNNNNNNNNNNNNNNNCGC
TACGTCTTCGGTCATGGGCACCGCGACTTGAGTGAGTGGCTCCATCATCAACGCATTCGTTGTTAGGCAGTACACGCCTGGGAGCACGCGCCGACCGCCT
TCTGCGACGCCTGCCGCTGCGGAACCAGCAGCAGCAGATCCAGAATGTTGTGTATCGTGCTGCTCAATCGAGTCGAAAAACTCATCGTCGCTCCCCGGTG
AGTCGTCGACTGCTTCTTCGCTAGCGATATTGTCATCATCGTAATCAAGGGTAAAGGACG