Description :
From Genome Similarity Track
Location :
Scaffold_88:77900- 85183
Sequence
7283 bases(100 bases per row)
CTAACTTCCTCTAGCTCAAAGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGA
AGTTCGTTGCCATGGCCAGGAGCGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCGGCA
AAGCCTGGTGGTGTCAGCATCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTTGACGTGTACGAGCAGGGCCTCATCGCGCATGTGCGGAAAAACCTGCAG
GCTCCGGCGGCGGAAGCAAATCCGCCTCACCCAAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGGAGGCGAGAACCTTCGCTTCTGGGTCC
GAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGCGTTGGGT
GACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCCGTGTGAACAGCTCCGAGCCGCGTTCCTGTCGGCCAGCTACGAGTACCGCC
AGCGTTCGCGCTTCCTCTCGTGCAAACAGGGGAGGCGTGAACTGCACGAGTACGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACT
CAACGAACACATCAAGATGACTGTGTTCATGGACAGCCTTCGAGTGGGTCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAACACCCTTGAAGAGGCG
ATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTTAGCCTGACCTGGGAGTTCCATGTCGGCCCCCGGTCGAACAAGTC
CCATAGGACCAGCTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCCGCTTCGGCTGCGGGAGGATGGGCCACTTCAAGCGCGACTGTCCCGC
GGAAAAACTCCGCAGACGGTCTTTCCCCAAGCCCGTCCTCAAGGGTCACTGGCAGAAGCCAGGATCCCGGGGACAGGGTAACGCCGGAAACCAGTAGGGG
CGGGGCGCCCTTCTGAGGAAGAACTAAGTTTTCGTGATGGGTGCGTGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAAAGTCTTCGCACTCTCGAATC
GGCGAAGAGCAGCGGCGGGTTGCGCGTAGTACACGGTCGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTC
GCACGCCGCCAGACAGGTGCTCGTAATAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGA
AGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCCTGTTTGAAGACTTTGACAGCCTCGAACAGCTCACAGTTCTTGACATGGATCCGTACGA
TATGATCCTGGGCATGCCCTGGCTTGAGGTGCACGAGCCCTGGATCGACTGGCGAGGCAAAACAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCA
TTGGTGAGTCATGTTCCACCTCTGTCAGGACCCGGGGCACCCGCAAGGGTTGCCAGGGTACCAAAGCATCCGGCAGATGCTTTAGAGGCGTCGACGTATA
TGACGACTCCAAGGATGCTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACA
GCTGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGAT
ACGCTTCCTGTGTGGGTAACAAAAATCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCCGTGTGGGTACCATAGTACC
ACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGCCGACATCCCTAGACATGGGCAGCAAAGCTTCACGTCGCGGTCGCCGTCGTCAACGACGCCACCGC
CGCCTCAAGTCGGATCCGAACTTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGCGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTT
ATCACATCTTCGATGGCGAGACCGGTTTGCCCGTCAAGGCATCTGGTGTTCACTTGGAACCGTTGCCAGAGGTTGCTGTTTTACTAACCCTCGAGGAAAT
GACGGTTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCCGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCT
GTCTTGGACGAGAACGTCCTGGAAGACCTAAACAGACAGCGTCAGACGCGCTTGGGTTCTGAGATCTTAAAGCACCCCAAGGGTCCGGTGTATCCTTTGG
TAACGGAGTATGCGGACGTGGTGAACAAAGACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCATGAGATTGATCTCGTGCCCGGCACCAAGTA
TTGTGTCACGAGGCAGTGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAA
TCCCCGCACTCGACGCCGACTTTCTGCGTTCGAAAGCCGAATGGAAAGTGGCGTCCGGTTCACGCTTAAAACAAGCTGAACAACGCAATGGTGCCGGCCC
AAACACCAATCCCACGAGAGGATGTGTTGTTAAACAACATGGCCGGGAGCGTTCTGTACAGCGCGCTGGATTTGGTAGACGTATACTACCAACTCCTGAT
GCGGGAGAGTGATATCTTGCTCACCGCGGTGAGCACCTCAAGCGACATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGTGACG
TTCAATCGCCTGGTGACGCAGCTGTTCCGCCCTTTGTGTACCTTCGTACAGGCGTACTTCGACGCCATATTCGTCCATAGCCGTGCCGAGGGAGGCAATA
CAGCCATGGAGGTGCATCTAGGACAACTCCGTCGAGTGTTGGACGTAATGCGAACGAGCAAGCTCTACGTCAACATCGACAAGTGCGTTTTCGCGTCACC
AGAGATTAAAGCACTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAACAGCATGGCCGACACCCCGATCCCAA
AAGGAACTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGG
ACGCCGACTGGCGCTGGGCGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCTATTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAA
GCCCTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACATGAACGAGTCATCGTTCCAGTCCAG
GCAGCTCAAAGTCGCCGAGCGAAACTACCCTATCCACGACAAGGAACTCCTGGCAATGCAATATGCCCTTGTAAAGTTTCGTGTTCACCTTCCGGGCTCT
CGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGGACGGCGACTAACTCGCTTCACCTATCCCAAAGGATGGCGAGGTGGCTGTTCTTCTTCGCGG
AGTACAACTTCCGCGCCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCAGACGCCCTCTCTCGGCGTCCTGACTATGAGTTGGCCCACATCACACGGGT
GACAATGAATCTATATGATCGGATACGCATGGTGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGCTCCTTATGTCCGACTGGCTCTCGTCGCGA
CAGCGCTCACGGCTCCACCGATAGGAGTTGAAGGATGGCCTTCTCTACTACCGGGTGGAGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACGAGG
ATCTGAAGTTCGATATCCTCGCAGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGTCGCGAGAAGACCTTTCTGTCGGTCGGTCTCAGGCCTTCTGG
TGGACCCACATGTACAAGTGGGTCGCCCGGTACGCTAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCC
TGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGATGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCG
GCTGAGCAAGATGGTACATCTTGCTCCGGTTCCCGTCACTGGTATGGGCGAACAAACCGCAAGGTTCTTCGTTGATGGCGTGTTCCGCTATCACGGTCTC
CCGGAGACGATTGTCGCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTTCCTTTACTGAGAACTCGTCTGCAGATGTCCACTGCGG
ACCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCA
GCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCTACGGTGCTCACGCCGCTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTC
ACGCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAAGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGATACCAGTTTCGCCGGAAA
CAAGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGCCAGCAGGGTCCGCGATGACATGGCAGCGGCGCAAGATAAACAAAAGGAGTACTCCGACAAAC
ATTGAAGAGTGAACTTAAGTGTATTTAAAGTGGGGGGCTTAGTGTTACTAGACACGAGGAGCCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCGATAA
GCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCCTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTC
TATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGT
CGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCAGTCGGAACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCGTACGAACGGACCCCGGAG
CCATACGCCGAGTACGCTGAGTACGCCGGATACGCACCATTCGCGTACGTCTGGGAGTGTGCCGCAGCCGGCTCCGGACGTGGCAGCAGAGCCTCGATCC
GTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGATGCAGGCTCGCGACCTCTCGCTTCAACAGGTCCAGGCG
GCGCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGA
CGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGCCGGAGCACTCGGACGAGAGTGGCGTTCGAGAGGCGCCGAGTACTCGTACTCGTACGAGG
GCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGCCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGA
TGTGGAGGGGTTATGCTCACTCCGATAACTCGTGGGAACCGATCGAACGGCTCCTGATTGACTGCGCGAAGGCTGTCGCAATCTGAAAACAGAAGCGGCG
GCAGCTAAACAAATAGTCCGGGCTTCTTGCCCGAACGGGGTACGGACGTTGAATACACTCCGTACCCGCGCTCATCGTGAGCGCTGGAAGCCGCACGCTT
CAAGATGTCCCTTGGCAGCATGCGCTTGCTGACCAAGTGGGCAAACCGAACACGACGATCACGCTGATCCAGGATACGGGACAGCAGCTAGTCTTCATGG
AGCTCCCGTAACTCCGTGGGTGAGTACTCGAGAGACTCCACCCATGCCCAGAACATGTCCTCACAAGAACGCCAGGTGGGGCAGTTCTCGGGCATAACCC
AGGGGTATCCCCAAAGAGGATAGAGCCCACCCCGGTTCTCGGGCTTCTTACGACAAGTCGTAAAGTCCTTAAGGAGGATGCGGTGTTGCGCGAGAAGCAC
ACACCGAGCAGCCTCCAAGTCGTCAACGAACAGCTGTTCTTTCTGAACAAGGGCACGTTCGTAAATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGA
GGAGCGACGAGAACCTCTAAGAATAGGACATCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGGCCAC
TACCAAACCCCCACGCACACGCTGGGCAGCTTGAAAGTCCTCCTGCTGCTGGTCGAGGTCATTCGTGACCTCCCGGGGTTCAGAGATAGCACCCTCCTCC
TCCTCTTTTTCCTCCTTCTTTTCCTCTTCCTCCCAGGAGTCGAAGATGCCCCGATGGGAGTGCCAAGTCTCCTTCTCCTCGCGGAGTGGAGACATAAAGG
GTGTACGGTTATTTGAGGGCTTGGTGCCTTCGTCTTTAGAGGCCTTGGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTTTTTCTC
ATCGCCACCAGCTTTGGGAATGCCCTTAGCCTTGATGGCCGGACTCTCAGAGCGCACAGACGTCCTGGGACTGTGATTACCTTGATCACTAGCGAGCGAC
TGCACGCTGTCATCCTTGTGCTCACTGGGCACTGGGCTGTGCCCTTCCGCAGAGCCCGCAGGAGCATCGTACGTGCTCTCGGACTCGTCTTCGTCCTCAC
TGCCAGAGTCGAACTCCGGTTCTACGAACCGAGGGTTCGGACGATTGTCTGGAGAGGCCGAGGGCGACGGGCTGCGACGCTTGCTTGCTCGCTTGCCCAC
AGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCCGAGCTATTGCCATGAGGCTTAG